Visible Radiation Affects Epidermal Permeability Barrier Recovery: Selective Effects of Red and Blue Light

      Abbreviations:

      SC
      stratum corneum
      SG
      stratum granulosum

      TO THE EDITOR

      In this study, we show that visible radiation (400–700 nm) in different wavelength ranges has different effects on the skin barrier recovery rate of hairless mice after barrier disruption.
      We disrupted the permeability barrier by tape stripping, and irradiation was started immediately. Blue light (430–510 nm) delayed the barrier recovery, whereas red light (550–670 nm) accelerated it, compared with the control kept in the dark. Green light (490–560 nm) and white light (400–670 nm) did not affect the barrier recovery rate (Figure 1a). During irradiation, the skin surface temperature was kept at 37°C in all cases, to prevent any effect of temperature, because we recently found that skin surface temperature influences the barrier recovery rate (
      • Denda M.
      • Sokabe T.
      • Tominaga-Fukumi T.
      • Tominaga M.
      Effects of skin surface temperature on epidermal permeability barrier homeostasis.
      ).
      Figure thumbnail gr1
      Figure 1Visible radiation affects the barrier recovery rate. Immediately after tape stripping, light (20 W) in the appropriate wavelength range was applied for 1 hour from a position 5 cm from the skin surface. (a) Neither green nor white light affected the barrier recovery rate. Asterisks indicate significant differences relative to dark control. In the skin organ culture system, blue light delayed the barrier recovery and red light accelerated it. (b) White light did not affect the barrier recovery rate.
      To confirm that the results reflected a biological phenomenon in the skin, that is, that they were independent of the nervous system or circulatory system, we next evaluated the effect of light on cultured sections of hairless mouse skin. In this organ culture system, blue light again delayed the barrier recovery and red light accelerated it (Figure 1b).
      Figures 2a–f show electron-microscopic pictures of the organ-cultured skin in Figure 1b. Compared with the control skin kept in the dark (Figure 2a), skin exposed to red light exhibited a thick intercellular lipid layer between the stratum corneum (SC) and stratum granulosum (SG) (panels c and d), whereas no such secreted lipid was observed between the SC and SG of skin exposed to blue light (panels d and f). The results are quantified in Figure 2g.
      Figure thumbnail gr2
      Figure 2Electron microscopic study of the skin exposed to visible light. Compared with the control skin kept in the dark (a) or exposed to white light (b), both of which demonstrate a thin intercellular lipid layer between the SC and SG, a remarkably thick intercellular lipid layer was observed between the SC and SG (black arrows) of the skin exposed to red light (c), whereas no secreted lipid was observed between SC and SG of skin exposed to blue light (d; between arrow heads). Bar=500 nm. (e and f) Close-ups of the lipid structure in (c) and (d), respectively. Bar=100 nm. (g) Quantitative results of changes in the area occupied by intercellular lipid.
      In the case of eye, rhodopsins at the retina play a crucial role as the receptors of red, green, and blue light. Rhodopsin is constructed from the protein opsin and retinol. A PCR assay suggested that opsin is expressed in the epidermis (data not shown).
      Although the mechanisms involved have not been clarified, our findings indicate that visible light exerts wavelength-dependent effects upon epidermal barrier homeostasis.

      Materials and Methods

       Materials

      All experiments were performed on 7- to 10-week-old male hairless mice (HR-1, Hoshino, Japan). All procedures in the measurement of skin barrier function, disruption of the barrier, and application of test sample were carried out under anesthesia. All experiments were approved by the Animal Research Committee of the Shiseido Research Center in accordance with the National Research Council Guide (
      • National Research Council
      ).

       Visible light radiation

      To obtain radiation of each wavelength range, we used arrays of 50 light-emitting diodes (
      • Nakamura S.
      The role of structural imperfections in InGaN-based blue light-emitting diodes and laser diodes.
      ) (lamp type 5 mm series, Nichia, Tokushima, Japan). The power level was set at 20 W (W=joules of energy per second) with a variable resistor. Radiation was applied for 1 hour from the light-emitting diodes placed at 5 cm from the surface of the skin or skin section, immediately after barrier disruption by tape stripping (
      • Denda M.
      • Sato J.
      • Tsuchiya T.
      • Elias P.M.
      • Feingold K.R.
      Low humidity stimulates epidermal DNA synthesis and amplifies the hyperproliferative response to barrier disruption: implication for seasonal exacerbations of inflammatory dermatoses.
      ). During the radiation, the temperature at the surface of the skin or skin section was kept at 37°C by the use of a heat pad.

       Cutaneous barrier function

      Permeability barrier function was evaluated by measurement of transepidermal water loss with an electric water analyzer (Meeco, Warrington, PA) as described previously (
      • Denda M.
      • Sokabe T.
      • Tominaga-Fukumi T.
      • Tominaga M.
      Effects of skin surface temperature on epidermal permeability barrier homeostasis.
      ).

       Organ culture study

      Immediately after euthanasia of hairless mice by pentobarbital application, flank skin (2 × 2 cm) was taken and the barrier was disrupted by acetone treatment as previously described (
      • Denda M.
      • Sato J.
      • Tsuchiya T.
      • Elias P.M.
      • Feingold K.R.
      Low humidity stimulates epidermal DNA synthesis and amplifies the hyperproliferative response to barrier disruption: implication for seasonal exacerbations of inflammatory dermatoses.
      ). Then the skin sections were incubated with DMEM (Cellgro Mediatech, Herndon, VA) at 37°C under different conditions of light exposure for 1 hour. At the end of the incubation, the transepidermal water loss was evaluated and tissue was taken for electron-microscopic study.

       Electron-microscopic study

      Full-thickness skin samples for electron microscopy were cut into pieces (<0.5 mm3) and fixed overnight in modified Karnovsky's fixative. They were then post-fixed in 2% aqueous osmium tetroxide or 0.2% ruthenium tetroxide as described previously (
      • Denda M.
      • Sato J.
      • Tsuchiya T.
      • Elias P.M.
      • Feingold K.R.
      Low humidity stimulates epidermal DNA synthesis and amplifies the hyperproliferative response to barrier disruption: implication for seasonal exacerbations of inflammatory dermatoses.
      ). Parameters were evaluated from photographs of randomly selected sections at a constant magnification, using computer software (NIH Image).

       Reverse transcription-PCR assays

      We used four mice for the assay. Epidermis of the skin tissue was removed by incubation in a 10 mM EDTA phosphate-buffered saline solution at 37°C for 30 min and total RNA was isolated by ISOGEN (Wako, Osaka, Japan), containing phenol and guanidine thiocyanate, according to the manufacturer's instructions. The resulting pellet was suspended in 10 μl of water, and 2 μl was analyzed by PCR. For opsin5 analysis, primer 1 (AGTCTGTGATCTGGGGATATCAGG region 228–402, 175 bp) and primer 2 (ACAGAT CTTCAG ATA GCGG TCCAG region 228–377, 150 bp).

       Statistics

      Results are expressed as the mean±SD. The statistical significance of differences were determined by analysis of variance with Fisher's protected least significant difference.

      Conflict of Interest

      The authors state no conflict of interest.

      REFERENCES

        • Denda M.
        • Sato J.
        • Tsuchiya T.
        • Elias P.M.
        • Feingold K.R.
        Low humidity stimulates epidermal DNA synthesis and amplifies the hyperproliferative response to barrier disruption: implication for seasonal exacerbations of inflammatory dermatoses.
        J Invest Dermatol. 1998; 111: 873-878
        • Denda M.
        • Sokabe T.
        • Tominaga-Fukumi T.
        • Tominaga M.
        Effects of skin surface temperature on epidermal permeability barrier homeostasis.
        J Invest Dermatol. 2007; 127: 654-659
        • Nakamura S.
        The role of structural imperfections in InGaN-based blue light-emitting diodes and laser diodes.
        Science. 1998; 281: 956-961
        • National Research Council
        National Research Council (NRC) Guide. National Academy Press, Washington1996