Advertisement

In Human Keratinocytes the Common Deletion Reflects Donor Variabilities Rather Than Chronologic Aging and can be Induced by Ultraviolet A Irradiation

      Mitochondrial DNA mutations play a major role in human aging processes and degenerative diseases. The most frequently reported marker for mutations of the mitochondrial DNA in human skin is a 4977 bp large-scale deletion, called the Common Deletion. Although this deletion is rarely detectable and constitutes only one example of the multitude of about 50,000 known mutations in mitochondrial DNA, it can represent “the tip of the iceberg” of all types of mitochondrial DNA mutations. We established a quantitative real-time polymerase chain reaction assay to detect the Common Deletion in vitro as well as in vivo/ex vivo. In contrast to previous studies, we were able to demonstrate that the Common Deletion is frequently abundant in keratinocytes isolated from various donors. Quantitative analysis of the mutation indicated interperson variations but obviously no relation to the donors' ages. Prolonged proliferation of keratinocytes led to a distinct reduction in the amount of the Common Deletion. Single ultraviolet A irradiation (12 J per cm2 and 15 J per cm2) neither in vitro nor in vivo increased the incidence of the mutation in keratinocytes, whereas repetitive irradiation resulted in a clear increase in vitro. Again, prolonged cultivation of these irradiated cells caused a significant reduction in the amounts of the deletion. In view of these results, the Common Deletion appears to be a useful marker rather for ultraviolet-A-induced alterations than for chronologic aging in human skin keratinocytes.

      Keywords

      NHEK
      normal human epidermal keratinocyte
      mtDNA
      mitochondrial DNA
      The human mitochondrial genome consists of a 16,569 bp circular, double-stranded DNA molecule present in approximately five copies per mitochondrion (
      • Satoh M.
      • Kuroiwa T.
      Organization of multiple nucleoids and DNA molecules in mitochondria of a human cell.
      ). The mitochondrial DNA (mtDNA) encodes 22 tRNAs, 2 rRNAs, and 13 proteins that are involved in mitochondrial gene expression and oxidative phosphorylation. mtDNA is directly exposed to oxidative stress, due to leakage of reactive oxygen species (ROS) from the electron transport chain. ROS are likely to damage mtDNA because it lacks a protective histone coat and its replication requires long single-stranded DNA regions. Oxidative stress exerts a mutagen potential and is assumed to cause the elevated mutation rate in mtDNA compared to nuclear DNA (
      • Richter C.
      Oxidative damage to mitochondrial DNA and its relationship to ageing.
      ). Oxidized mitochondrial bases and large-scale deletions correlate with oxidative stress (
      • Hayakawa M.
      • Hattori K.
      • Sugiyama S.
      • Ozawa T.
      Age-associated oxygen damage and mutations in mitochondrial DNA in human hearts.
      ;
      • Lezza A.M.
      • Mecocci P.
      • Cormio A.
      • et al.
      Mitochondrial DNA 4977 bp deletion and OH8dG levels correlate in the brain of aged subjects but not Alzheimer's disease patients.
      ); they accumulate with increasing age in differentiated tissues and are therefore considered to contribute to processes of aging and disease (
      • Wallace D.C.
      Mitochondrial genetics: a paradigm for aging and degenerative diseases?.
      ;
      • Wei Y.H.
      Oxidative stress and mitochondrial DNA mutations in human aging.
      ).
      The most abundant change in mtDNA is the so-called Common Deletion, which was originally observed in patients with mitochondrial myopathies (
      • Wallace D.C.
      Mitochondrial genetics: a paradigm for aging and degenerative diseases?.
      ). The deleted fragment of 4977 bp comprises five tRNA genes involved in mitochondrial gene expression and seven protein coding genes involved in oxidative phosphorylation. The deletion is considered as the product of an intragenomic recombination event taking place between two 13 bp direct repeats (positions 8470–8482 and 13447–13459) after a single-strand break in mtDNA caused by ultraviolet A (UVA) or ROS (
      • Shoffner J.M.
      • Lott M.T.
      • Voljavec A.S.
      • Soueidan S.A.
      • Costigan D.A.
      • Wallace D.C.
      Spontaneous Kearns-Sayre/chronic external ophthalmoplegia plus syndrome associated with a mitochondrial DNA deletion: a slip-replication model and metabolic therapy.
      ).
      The Common Deletion has been thoroughly investigated with respect to its appearance in disease and aging, and its possible use as a biomarker for aging. Several studies on the Common Deletion by polymerase chain reaction (PCR) have proven an age-related accumulation in various tissues. In highly differentiated tissues like muscle or nerve, the accumulation is much more distinct than in proliferating tissues like skin or liver (
      • Cortopassi G.A.
      • Shibata D.
      • Soong N.W.
      • Arnheim N.
      A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues.
      ;
      • Lee H.C.
      • Pang C.Y.
      • Hsu H.S.
      • Wei Y.H.
      Differential accumulations of 4,977 bp deletion in mitochondrial DNA of various tissues in human ageing.
      ;
      • Yang J.H.
      • Lee H.C.
      • Lin K.J.
      • Wei Y.H.
      A specific 4977-bp deletion of mitochondrial DNA in human ageing skin.
      ). This is presumably caused by energy deficiency of dividing cells carrying numerous copies of deleted mtDNAs (
      • Moraes C.T.
      • Schon E.A.
      • DiMauro S.
      • Miranda A.F.
      Heteroplasmy of mitochondrial genomes in clonal cultures from patients with Kearns–Sayre syndrome.
      ). In proliferating tissues like skin, the absolute amount of the Common Deletion remains low, and its detection is complicated by a surplus of nondeleted mtDNA. Therefore, little is known about the Common Deletion in cultured normal cells like primary keratinocytes.
      Optimized PCR techniques can be useful to measure even low concentrations of deleted mtDNA in mitotic active tissues (
      • von Wurmb N.
      • Oehmichen M.
      • Meissner C.
      Demonstration of the 4977 bp deletion in human mitochondrial DNA from intravital and postmortem blood.
      ). In this study, we established a sensitive TaqMan-PCR for quantitative analysis of low copy deleted mtDNA by using a short amplicon and short extension time, in combination with a fluorescence-labeled probe. Using this system, the ratio of mtDNA harbouring the Common Deletion to wild-type mtDNA was measured in primary human keratinocytes and in suction blister epidermis.

      Materials and methods

      Isolation of keratinocytes and preparation of primary cultures

      Human skin biopsies were obtained from the Universitaetskrankenhaus Eppendorf (Hamburg, Germany) in Dulbecco's modified Eagle's medium (Gibco BRL, Eggenstein, Germany) containing 20 mM HEPES, 20% fetal bovine serum (FBS), and 0.1 mg per ml gentamicin. The underlying fat was trimmed, and the samples were vigorously washed in phosphate-buffered saline (PBS) supplemented with 0.1 mg per ml gentamicin and 2.5 µg per ml amphotericin B. The samples were covered with 2.5 U per ml dispase I overnight at 4°C. The epidermal fraction was separated and subjected to trypsinization in trypsin (1 g per liter)/ethylenediamine tetraacetic acid (EDTA; 400 mg per liter) for 10 min at 37°C, followed by adding keratinocyte growth medium (KGM-2; Clonetics, Remagen, Germany) containing 10% FBS. The resulting epidermal single cell suspension consisting of about 95% normal human epidermal keratino cytes (NHEK) was centrifuged, and the cells were resuspended in KGM-2 without FBS and incubated at 37°C and 7% CO2 in a humidified atmosphere.
      Neonatal NHEK were supplied by CellSystems (St. Katharinen, Germany).

      Serial cultivation

      At a confluency of 50% primary cultures were incubated with trypsin (1 g per liter)/EDTA (400 mg per liter) in PBS for no more than 10 min at 37°C. Trypsinization was stopped with KGM-2 supplemented with 10% FBS, and the detached cells were dispersed into single cells by gentle pipetting. The cells were collected by centrifugation, suspended in KGM-2, and plated in appropriate dilutions.

      Cloning procedures

      Standard plasmids for TaqMan-PCR analysis were generated by cloning standard PCR products of NHEK DNA. Each standard PCR reaction (50 µl) consisted of 50 mM KCl, 10 mM Tris/HCl, 1.5 mM MgCl2, 200 µM each of the four dNTPs, 400 µM of each primer, 1 µg DNA, and 1.25 U Taq DNA polymerase (Perkin Elmer, Norwalk). Reaction mixtures were subjected to the following amplification scheme: 2 min initial denaturation at 97°C, 40 cycles of 1 min denaturation at 97°C, 1 min annealing at 66°C, and 1 min extension at 60°C. Amplification was completed by a final step of 10 min at 72°C. The reactions were carried out in a Perkin Elmer 9600 thermocycler.
      The sequence spanning the Common Deletion was amplified using the primers 5′-TACTACGGTCAATGCTCTGAAA-3′ and 5′-CTAGGG TAGAATCCGAGTATGTTG-3′, which were designed to recognize unique sequences found outside of the deletion close to the breakpoints. In deleted mtDNA molecules, these primers come close enough to synthesize the 793 bp PCR product within the given extension time, whereas in nondeleted mtDNA the distance between the primers is too long. The 83 bp fragment serving as internal standard for total mtDNA was amplified with primers IS1 and IS2 Table I, each binding to a unique sequence of the mtDNA independently of the presence of the Common Deletion. The two amplification products were subjected to cloning into the vector pCR 2.1 (3.9 kb) and transformed into INVaF′ cells using the Original TA Cloning Kit (Invitrogen, Groningen, Germany). Bacteria carrying recombinant plasmids were selected in LB-medium containing 50 µg per ml ampicillin and grown at 37°C to serve for plasmid preparation using the QIAfilter Plasmid Maxi Kit (Qiagen, Hilden, Germany). In order to ensure identity of standards, all inserts were reamplified and subjected to sequencing.
      Table ITaqMan primers and probes for detection of total mtDNA and mtDNA harbouring the Common Deletion
      TargetAmpliconOligonucleotide sequence (5′→3′)
      total mtDNA83 bpIS1 forward primer GATTTGGGTACCACCCAAGTATTG
      IS2 reverse primer AATATTCATGGTGGCTGGCAGTA
      IS probe
      VIC labeled.
      CACCCATCAACAACCGCTATGTATTTCGTACAp
      Common Deletion mtDNA108 bpCD1 forward primer ACCCCCATACTCCTTACACTATTCC
      CD2 reverse primer AAGGTATTCCTGCTAATGCTAGGCT
      CD probe
      FAM labeled.
      ACACAAACTACCACCTACCTCCCTCACCAp
      a VIC labeled.
      b FAM labeled.

      UVA irradiation in vitro

      NHEK were plated on 9 cm Petri dishes at 200,000 cells and incubated overnight. The following day, the medium was replaced with PBS and the cells were irradiated at room temperature without cover using Dermalight 2020 (Dr. Hoenle, Martinsried, Germany) and the UVB cut filter M-UG2 (Schott Glas, Mainz, Germany). Subsequently, the PBS was removed, fresh medium was added, and the cells were incubated at 37°C for 24 h previous to DNA preparation.

      Volunteer study and UVA irradiation in vivo

      Volunteers were exposed to 2 J per cm2 and 15 J per cm2 UVA on each arm with UVASPOT 400/K (Dr. Hoenle) through the UVB cut filter M-UG2 (Schott Glas). Suction blisters could be taken 24 h and 72 h postirradiation. In addition, a control was raised from a nonexposed site on both arms; therefore each volunteer served as his or her own control. The blisters were taken using a vacuum manifold with 5 mm diameter chambers and a negative pressure of 300–330 mbar (
      • Goldsmith L.A.
      • DeYoung L.M.
      • Falciano V.
      • Ballaron S.J.
      • Akers W.
      Inhibition of human epidermal transglutaminases in vitro and in vivo by tyrosinamidomethyl dihydrohaloisoxazoles.
      ). When a blister filled the 5 mm chamber, the vacuum was released. The blister was disinfected, excised with scissors, and washed in PBS directly followed by DNA extraction.

      DNA extraction and analysis

      DNA extraction was performed using the QIAamp DNA Blood Mini Kit (Qiagen) for cultured cells and suction blister epidermis according to the manufacturer's protocols. These ensure the isolation of total (nuclear and mitochondrial) DNA. Total DNA concentration was determined using the GeneQuant RNA/DNA Calculator (Pharmacia Biotech, Cambridge, U.K.).

      TaqMan-PCR

      The quantitative TaqMan-PCR method provides real-time measurement of target input as PCR accumulation through a dual-labeled probe. This probe anneals between forward and reverse primer, and it is cleaved by the 5′-3′ exonuclease activity of Taq polymerase during the PCR extension phase. Therefore, the 5′-terminal reporter dye FAM (6-carboxyfluorescein) or VIC and the 3′-terminal quencher dye TAMRA (6-carboxy-N, N, N′,N′-tetramethylrhodamine) linked to the probe get separated, resulting in a fluorescence emission of the reporter dye. The probe is not able to serve as primer itself because it is 3′-terminally blocked with a phosphate group.
      Amplification reactions were performed as 25 µl triplicates in a 96-well microplate format. Total mtDNA and deleted mtDNA reactions were carried out in separate tubes, each containing 100 ng DNA, 1 × TaqMan Universal PCR Master Mix, 300 µM dATP, dCTP, and dGTP, 600 µM dUTP, 300 µM of each IS primer, or 300 µM of each CD primer. The reactions were completed by adding 225 nM of the specific IS probe or CD probe Table I. Primers and probes were designed using the Primer Express 1.0 software Figure 1. All reagents were supplied by PE Applied Biosystems (Weiterstadt, Germany). The thermal cycling conditions included a preincubation step of 2 min at 50°C for activation of AmpErase UNG to eliminate carry-over contamination, and 10 min at 95°C for its deactivation. This initial step was followed by 40 cycles of 15 s at 95°C and 1 min at 60°C.
      Figure thumbnail gr1
      Figure 1Localization of TaqMan-PCR primers and probes. Schematic representation of the human mtDNA with Common Deletion showing the position of oligonucleotide primers and probes. Primers IS1/IS2 and IS probe (VIC labeled), annealing to both wild-type and deleted mtDNA, were used to amplify and detect 83 bp total mtDNA fragments as internal standard. Detection of 108 bp DNA fragments originating only from mtDNA harbouring the Common Deletion was performed with primers CD1/CD2 and CD probe (FAM labeled). The specific CD probe anneals only on deleted mtDNA as it needs to bind exactly to the deletion junction. Furthermore, the deletion brings the CD primers close enough to generate an amplicon under the given PCR conditions.

      Quantification of DNA copies

      Analysis of the reactions was carried out in an ABI PRISM 7700 Sequence Detector equipped with the Sequence Detection software version 1.6 (PE Applied Biosystems, Foster City). Real-time detection continuously monitored an increase in reporter dye (either FAM or VIC) fluorescent emission during each PCR cycle in every PCR tube. The Rn value is the ratio of the emission intensity of the reporter dye to the emission intensity of the passive reference, a dye included in the TaqMan reaction buffer. ΔRn is defined as the difference between Rn+ (Rn of a reaction containing all components including template) and Rn (Rn of a no template control). The cycle at which a statistically significant increase in ΔRn is detected first is called the threshold cycle (CT). Fluorescence signals are regarded as significant if the fluorescent intensity exceeds 10-fold the standard deviation of the background Rn value to define a threshold. Absolute DNA quantification was performed using the standard curve method. Reactions were carried out with different concentrations of two standard plasmids (see cloning procedures) in parallel to the samples that should be quantified. The standard plasmids, one carrying sequences flanking the Common Deletion and one carrying a unique sequence of the mtDNA independently of the Common Deletion, allowed the generation of two standard curves showing the number of copies of total mtDNA or mtDNA harbouring the Common Deletion versus the measured CT. The CT values of samples could then easily be converted to the number of DNA copies by comparing CT for the sample to CT for the respective standard plasmid of known concentrations. The amount of mutation corresponds to the ratio of mtDNA with Common Deletion to wild-type mtDNA within each sample. If not detected within 40 cycles (CT = 40), DNA is considered absent. CT > 36 and CT < 40 represent measured data, but for absolute quantification only values of CT ≤ 36 were used as they are much more reliable.

      Results

      The quantitative TaqMan-PCR detects the 4977 bp Common Deletion in mtDNA

      The 83 bp standard PCR fragment originating from mtDNA and the 793 bp PCR fragment from mtDNA harbouring the Common Deletion were cloned and sequenced to confirm the specificity of inserts. The 793 bp fragment contained the characteristic deletion junction created by the Common Deletion and therefore carried only one of the two 13 bp repeats that normally flank wild-type mtDNA. Measuring serial dilutions of deleted mtDNA standard plasmids versus total mtDNA standard plasmids using TaqMan-PCR, 100 deleted molecules in 108 mtDNA copies could be detected with CT ≤ 36, which is equivalent to a sensitivity of 0.001‰.

      The Common Deletion shows high interperson variation in keratinocytes isolated from human skin

      The amount of the 4977 bp Common Deletion was analyzed in epidermal keratinocytes derived from areas of chronic sun exposure (head) and nonexposed areas (waist, back, thigh, and paunch) of human skin. The donors' ages ranged from 30 to 78 y. Table II shows the incidence of the Common Deletion in keratinocytes of 27 independent donors in the first passage. In eight samples the mutation either could only be detected in minimal levels (CT > 36) or could not be detected at all (CT = 40). Nineteen samples showed CT ≤ 36 revealing proportions of the mutation from 0.001‰ to 0.822‰. Statistical analysis was carried out using Pierson's correlation analysis, which could not show any correlation between the incidence of the Common Deletion and either the age of the donors or the site and possible UVA exposure of the sample.
      Table IIAmount of the Common Deletion in first passage keratinocytes from adult human skin evaluated by TaqManTM-PCR
      Sample numberAge [y]SexSiteCD+ [‰]
      Results are expressed as copies of deleted DNA out of 1000 total mtDNA molecules.
      UV exposure
      Possible UVA exposure was estimated with regard to site of sample material.
      130–40
      No precise donor age was available.
      malewaist0.822nonexposed
      240–50
      No precise donor age was available.
      malehead0.000
      CT > 36 were considered background.
      exposed
      340–50
      No precise donor age was available.
      maleface0.000
      CT > 36 were considered background.
      exposed
      440–50
      No precise donor age was available.
      maleface0.011exposed
      544maleback0.009nonexposed
      646femalewaist0.106nonexposed
      749femalethigh0.000
      CT > 36 were considered background.
      nonexposed
      852femaleface0.000
      CT > 36 were considered background.
      exposed
      953femaleear0.201exposed
      1053femaleface0.000
      CT > 36 were considered background.
      exposed
      1155femaleforehead0.013exposed
      1255femalepaunch0.004nonexposed
      1356femaleeyelid0.000
      CT > 36 were considered background.
      exposed
      1458femaleface0.012exposed
      1558femaleface0.239exposed
      1659femaleface0.200exposed
      1759femaleface0.083exposed
      1860unknownunknown0.734unknown
      1960–70
      No precise donor age was available.
      femalethigh0.004nonexposed
      2061femaleface0.061exposed
      2161femaleface0.002exposed
      2261femaleface0.063exposed
      2368maleforehead0.000exposed
      2473femaleunknown0.001unknown
      2573femaleface0.102exposed
      2675femaleface0.000
      CT > 36 were considered background.
      exposed
      2778femalethigh0.002nonexposed
      a Results are expressed as copies of deleted DNA out of 1000 total mtDNA molecules.
      b Possible UVA exposure was estimated with regard to site of sample material.
      c No precise donor age was available.
      d CT > 36 were considered background.

      Incidence of the Common Deletion during cultivation of NHEK

      As deleted mtDNA molecules are extremely reduced in length without direct alteration of the two replication start points, they were expected to replicate more quickly and therefore accumulate with time. Otherwise the cells must possess an internal control system, which reduces or avoids the replication of deleted DNA in mitochondria. In order to determine the incidence of the Common Deletion during cultivation, seven of the keratinocyte cultures, derived from skin biopsies, were cultivated up to passage 4. A portion of the cells of each passage was used to prepare total DNA and to determine the amount of the Common Deletion. Figure 2 shows an immense decrease in the incidence of deleted mtDNA molecules during cultivation in all samples to less than 0.10‰.
      Figure thumbnail gr2
      Figure 2The incidence of the Common Deletion in keratinocytes decreases from the first to the fourth passage. Epidermal keratinocytes derived from seven human skin biopsies were cultivated separately and subjected to total DNA preparation. Quantitative TaqMan-PCR using the standard curve method was carried out in order to determine the ratio of deleted mtDNA to total mtDNA. The donors were aged 30–40 y, 46 y, 58 y, 59 y, and 73 y.

      Induction of the Common Deletion in vitro by UVA irradiation

      Three independent cultures of different neonatal keratinocytes were each subjected to a single UVA irradiation in passage 2 with 2 J per cm2, 7 J per cm2, and 12 J per cm2 UVA. In addition, the cells were irradiated with the same doses three times at intervals of 10 h. The ratio of the Common Deletion to total mtDNA was examined 24 h postirradiation. Single UVA irradiation only resulted in slight changes in the frequency of the Common Deletion Figure 3a. In contrast, triple irradiation led to a clearly dose-dependent increase in all three cell lines Figure 3b.
      Figure thumbnail gr3
      Figure 3Triple UVA irradiation, in contrast to single irradiation, induces the Common Deletion in neonatal human keratinocytes. The ratio of the Common Deletion to total mtDNA was determined in second passage neonatal keratinocytes treated with 2 J per cm2, 7 J per cm2, and 12 J per cm2 UVA. The cells were subjected to either (a) single irradiation or (b) triple irradiation at intervals of 10 h. Total DNA was prepared 24 h after irradiation sessions and analyzed using TaqMan-PCR. Reactions were carried out in triplicate; results are mean values ± SD.

      Incidence of the Common Deletion during cultivation of UVA-irradiated neonatal keratinocytes

      In order to compare the level of the Common Deletion between irradiated cells in passages 2 and 4, three different neonatal keratinocyte cultures were cultivated to passage 4 after triple exposure to 2 J per cm2, 7 J per cm2, and 12 J per cm2 UVA. Keratinocytes with a relatively high amount of the Common Deletion in passage 2 showed a significant decrease of the mutation during prolonged proliferation Figure 4a, b and c. Cells with low abundance of the Common Deletion remained at this stage during cultivation. These data are consistent with the findings in nonirradiated keratinocytes isolated from adult human skin after prolonged cultivation.
      Figure thumbnail gr4
      Figure 4The frequency of the Common Deletion in UVA-irradiated neonatal keratinocytes reaches the level of the unirradiated control in passage 4. (a–c) Three independent cultures of neonatal keratinocytes were cultivated after triple exposure to 0 J per cm2, 2 J per cm2, 7 J per cm2, and 12 J per cm2 UVA in passage 2. The amount of the Common Deletion was evaluated by TaqMan-PCR after DNA isolation in passages 2 and 4.

      Detection of the Common Deletion in suction blister

      Suction blister epidermis served as a system for measuring the Common Deletion in vivo. Five volunteers, aged from 24 to 41 y, were exposed to 2 J per cm2 and 15 J per cm2 UVA radiation on each inner forearm. As the deletion needs a DNA replication step to arise, suction blister epidermis was taken 1 and 3 d after irradiation sessions. The amount of the Common Deletion did show interperson variations with levels from 0.02‰ to 1.39‰ irrespective of irradiation dose. In addition, relatively high intraperson variations were obtained, even on control areas without UVA exposure Figure 5a, b.
      Figure thumbnail gr5
      Figure 5Incidence of the Common Deletion in suction blister epidermis of five volunteers. Volunteers were irradiated with 2 J per cm2 and 15 J per cm2 UVA on each inner forearm and three suction blisters were taken (a) 24 h postirradiation from the right arm and (b) 72 h postirradiation from the left arm. The donors' ages were 24 y, 30 y, 32 y, 38 y, and 41 y. Suction blister epidermis directly served for DNA preparation, followed by TaqMan analysis. Reactions were carried out in triplicate; results are mean values ± SD.

      Discussion

      The incidence of the mitochondrial 4977 bp Common Deletion has been investigated most intensely in slowly dividing tissues like skeletal muscle and brain tissues where levels seem to be highest (
      • Corral-Debrinski M.
      • Horton T.
      • Lott M.T.
      • Shoffner J.M.
      • Beal M.F.
      • Wallace D.C.
      Mitochondrial DNA deletions in human brain: regional variability and increase with advanced age.
      ;
      • Bogliolo M.
      • Izzotti A.
      • De Flora S.
      • Carli C.
      • Abbondandolo A.
      • Degan P.
      Detection of the ‘4977 bp’ mitochondrial DNA deletion in human atherosclerotic lesions.
      ). In this study, we developed a sensitive TaqMan-PCR system that allowed us to detect low concentrations of the Common Deletion in human keratinocytes that show relatively high mitotic activity. The TaqMan-PCR is superior to standard PCR techniques due to its suitability for quantitative analysis. It benefits by very short amplicons and extension times and avoids nested PCR, applied by other groups to measure deleted mtDNA in proliferating cells (
      • Gattermann N.
      • Berneburg M.
      • Heinisch J.
      • Aul C.
      • Schneider W.
      Detection of the ageing-associated 5-kb common deletion of mitochondrial DNA in blood and bone marrow of hematologically normal adults. Absence of the deletion in clonal bone marrow disorders.
      ;
      • Berneburg M.
      • Grether-Beck S.
      • Kurten V.
      • Ruzicka T.
      • Briviba K.
      • Sies H.
      • Krutmann J.
      Singlet oxygen mediates the UVA-induced generation of the photoaging-associated mitochondrial common deletion.
      ). The serial dilution method was used to perform absolute quantification of DNA copy number, and a sensitivity of 0.001‰ could be reached.
      We examined 27 human skin samples from various donors aged between 30 and 78 y and observed high interperson variation in the amount of the Common Deletion from 0.001‰ to 0.822‰. In addition, human dermal fibroblasts revealed similar results (data not shown). There was no detectable accumulation of the Common Deletion in keratinocytes with increasing age in vitro. This finding is in contrast to previous studies that determined the frequency of the Common Deletion in different tissues (
      • Cortopassi G.A.
      • Shibata D.
      • Soong N.W.
      • Arnheim N.
      A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues.
      ;
      • Yang J.H.
      • Lee H.C.
      • Lin K.J.
      • Wei Y.H.
      A specific 4977-bp deletion of mitochondrial DNA in human ageing skin.
      ). In skeletal muscle, brain tissue, and blood cells the incidence of the Common Deletion clearly increases with age of the donors (
      • Corral-Debrinski M.
      • Horton T.
      • Lott M.T.
      • Shoffner J.M.
      • Beal M.F.
      • Wallace D.C.
      Mitochondrial DNA deletions in human brain: regional variability and increase with advanced age.
      ;
      • Gattermann N.
      • Berneburg M.
      • Heinisch J.
      • Aul C.
      • Schneider W.
      Detection of the ageing-associated 5-kb common deletion of mitochondrial DNA in blood and bone marrow of hematologically normal adults. Absence of the deletion in clonal bone marrow disorders.
      ;
      • Bogliolo M.
      • Izzotti A.
      • De Flora S.
      • Carli C.
      • Abbondandolo A.
      • Degan P.
      Detection of the ‘4977 bp’ mitochondrial DNA deletion in human atherosclerotic lesions.
      ). Therefore, the Common Deletion seems to be useful as a biomarker for aging in slowly dividing tissues but not in fast dividing cells like keratinocytes.
      Prolonged cultivation of keratinocytes derived from seven skin biopsies was carried out to examine the incidence of the Common Deletion during proliferation. As the mutation does not directly affect the two replication starting points of mtDNA, deleted mtDNA molecules were expected to show wild-type or even higher replication rates due to their reduced length. Conversely, we observed a significant decrease in the relative amount of the Common Deletion of up to 90% in all samples within two passages. Our results suggest a mechanism that either reduces or blocks replication of deleted mtDNA or ensures degradation of mitochondria bearing the Common Deletion. As mitochondria carrying deleted mtDNA molecules might concentrate due to mitotic segregation, affected cells could die as a consequence of reduced activity of the respiratory chain. A decrease in the amount of the Common Deletion related to a regeneration of respiratory activity in human fibroblasts has already been described by
      • Bourgeron T.
      • Chretien D.
      • Rotig A.
      • Munnich A.
      • Rustin P.
      Fate and expression of the deleted mitochondrial DNA differ between human heteroplasmic skin fibroblasts and Epstein-Barr virus-transformed lymphocyte cultures.
      .
      The present model describes the Common Deletion as a product of an intragenomic recombination event that requires a single-strand break in mtDNA. This damage might be induced by UVA radiation or ROS. In our study, a single UVA irradiation of human neonatal keratinocytes with 2 J per cm2, 7 J per cm2, and 12 J per cm2 did not result in a distinct increase in the relative amount of the Common Deletion. A considerable induction could only be observed after triple exposure to the same UVA doses.
      • Berneburg M.
      • Grether-Beck S.
      • Kurten V.
      • Ruzicka T.
      • Briviba K.
      • Sies H.
      • Krutmann J.
      Singlet oxygen mediates the UVA-induced generation of the photoaging-associated mitochondrial common deletion.
      , who investigated the effect of UVA on human dermal fibroblast cultures using nested PCR, were able to detect the induction of the Common Deletion after repetitive irradiation with 8 J per cm2 UVA. As the effect was dependent on the presence of ROS, the single-strand break seems to be mediated by UVA-generated reactive oxygen.
      Triple-irradiated neonatal keratinocytes were cultivated up to passage 4. The incidence of the Common Deletion in all samples reached the level of the nonirradiated control after prolongation. This finding is consistent with the data on cultivated adult keratinocytes, which indicated a selective mechanism eliminating deleted mtDNA molecules or keratinocytes carrying the Common Deletion.
      The TaqMan assay established in this study is applicable to experiments in vitro as well as in vivo due to the relatively small amount of sample material required. We investigated irradiated suction blister epidermis as an example of in vivo samples. All sites irradiated with 2 J per cm2 and 15 J per cm2 and nonirradiated control areas showed high interperson variations in the incidence of the Common Deletion irrespective of irradiation dose. This observation is in accordance with the data on cultivated NHEK after a single irradiation. Additional intraperson variations are most probably caused by the mosaic distribution of cells during mitosis.
      The improved detection method described brings a new perspective for further research concerning the amount of deleted mtDNA depending on mitotic activity (
      • Cortopassi G.A.
      • Shibata D.
      • Soong N.W.
      • Arnheim N.
      A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues.
      ) and the involvement of the Common Deletion in photoaging of slowly dividing cells, posted by various groups (
      • Yang J.H.
      • Lee H.C.
      • Lin K.J.
      • Wei Y.H.
      A specific 4977-bp deletion of mitochondrial DNA in human ageing skin.
      ;
      • Berneburg M.
      • Grether-Beck S.
      • Kurten V.
      • Ruzicka T.
      • Briviba K.
      • Sies H.
      • Krutmann J.
      Singlet oxygen mediates the UVA-induced generation of the photoaging-associated mitochondrial common deletion.
      ).

      ACKNOWLEDGMENTS

      We thank F. Dietz, C. Lahmann, H. Mielke, and K. Venzke for technical assistance and helpful discussion.

      References

        • Berneburg M.
        • Grether-Beck S.
        • Kurten V.
        • Ruzicka T.
        • Briviba K.
        • Sies H.
        • Krutmann J.
        Singlet oxygen mediates the UVA-induced generation of the photoaging-associated mitochondrial common deletion.
        J Biol Chem. 1999; 274: 15345-15349
        • Bogliolo M.
        • Izzotti A.
        • De Flora S.
        • Carli C.
        • Abbondandolo A.
        • Degan P.
        Detection of the ‘4977 bp’ mitochondrial DNA deletion in human atherosclerotic lesions.
        Mutagenesis. 1999; 14: 77-82
        • Bourgeron T.
        • Chretien D.
        • Rotig A.
        • Munnich A.
        • Rustin P.
        Fate and expression of the deleted mitochondrial DNA differ between human heteroplasmic skin fibroblasts and Epstein-Barr virus-transformed lymphocyte cultures.
        J Biol Chem. 1993; 268: 19369-19376
        • Corral-Debrinski M.
        • Horton T.
        • Lott M.T.
        • Shoffner J.M.
        • Beal M.F.
        • Wallace D.C.
        Mitochondrial DNA deletions in human brain: regional variability and increase with advanced age.
        Nat Genet. 1992; 2: 324-329
        • Cortopassi G.A.
        • Shibata D.
        • Soong N.W.
        • Arnheim N.
        A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues.
        Proc Natl Acad Sci USA. 1992; 89: 7370-7374
        • Gattermann N.
        • Berneburg M.
        • Heinisch J.
        • Aul C.
        • Schneider W.
        Detection of the ageing-associated 5-kb common deletion of mitochondrial DNA in blood and bone marrow of hematologically normal adults. Absence of the deletion in clonal bone marrow disorders.
        Leukemia. 1995; 9: 1704-1710
        • Goldsmith L.A.
        • DeYoung L.M.
        • Falciano V.
        • Ballaron S.J.
        • Akers W.
        Inhibition of human epidermal transglutaminases in vitro and in vivo by tyrosinamidomethyl dihydrohaloisoxazoles.
        J Invest Dermatol. 1991; 197: 156-158
        • Hayakawa M.
        • Hattori K.
        • Sugiyama S.
        • Ozawa T.
        Age-associated oxygen damage and mutations in mitochondrial DNA in human hearts.
        Biochem Biophys Res Commun. 1992; 189: 979-985
        • Lee H.C.
        • Pang C.Y.
        • Hsu H.S.
        • Wei Y.H.
        Differential accumulations of 4,977 bp deletion in mitochondrial DNA of various tissues in human ageing.
        Biochim Biophys Acta. 1994; 1226: 37-43
        • Lezza A.M.
        • Mecocci P.
        • Cormio A.
        • et al.
        Mitochondrial DNA 4977 bp deletion and OH8dG levels correlate in the brain of aged subjects but not Alzheimer's disease patients.
        FASEB J. 1999; 13: 1083-1088
        • Moraes C.T.
        • Schon E.A.
        • DiMauro S.
        • Miranda A.F.
        Heteroplasmy of mitochondrial genomes in clonal cultures from patients with Kearns–Sayre syndrome.
        Biochem Biophys Res Commun. 1989; 160: 765-771
        • Richter C.
        Oxidative damage to mitochondrial DNA and its relationship to ageing.
        Int J Biochem Cell Biol. 1995; 7: 647-653
        • Satoh M.
        • Kuroiwa T.
        Organization of multiple nucleoids and DNA molecules in mitochondria of a human cell.
        Exp Cell Res. 1991; 196: 137-140
        • Shoffner J.M.
        • Lott M.T.
        • Voljavec A.S.
        • Soueidan S.A.
        • Costigan D.A.
        • Wallace D.C.
        Spontaneous Kearns-Sayre/chronic external ophthalmoplegia plus syndrome associated with a mitochondrial DNA deletion: a slip-replication model and metabolic therapy.
        Proc Natl Acad Sci USA. 1989; 86: 7952-7956
        • Wallace D.C.
        Mitochondrial genetics: a paradigm for aging and degenerative diseases?.
        Science. 1992; 256: 628-632
        • Wei Y.H.
        Oxidative stress and mitochondrial DNA mutations in human aging.
        Proc Soc Exp Biol Medical. 1998; 217: 53-63
        • von Wurmb N.
        • Oehmichen M.
        • Meissner C.
        Demonstration of the 4977 bp deletion in human mitochondrial DNA from intravital and postmortem blood.
        Mutat Res. 1998; 422: 247-254
        • Yang J.H.
        • Lee H.C.
        • Lin K.J.
        • Wei Y.H.
        A specific 4977-bp deletion of mitochondrial DNA in human ageing skin.
        Arch Dermatol Res. 1994; 286: 386-390