Advertisement

CD301b+ Macrophages Are Essential for Effective Skin Wound Healing

  • Brett Shook
    Affiliations
    Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, Connecticut, USA
    Search for articles by this author
  • Eric Xiao
    Affiliations
    Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, Connecticut, USA
    Search for articles by this author
  • Yosuke Kumamoto
    Affiliations
    Department of Immunobiology, Yale University School of Medicine, New Haven, Connecticut, USA
    Search for articles by this author
  • Akiko Iwasaki
    Affiliations
    Department of Immunobiology, Yale University School of Medicine, New Haven, Connecticut, USA

    Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, USA
    Search for articles by this author
  • Valerie Horsley
    Correspondence
    Correspondence: Valerie Horsley, Department of Molecular, Cellular and Developmental Biology, Yale University, 219 Prospect Street, Box 208103, New Haven, Connecticut 06520, USA.
    Affiliations
    Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, Connecticut, USA

    Department of Dermatology, Yale School of Medicine, New Haven, Connecticut, USA
    Search for articles by this author
Open ArchivePublished:June 07, 2016DOI:https://doi.org/10.1016/j.jid.2016.05.107
      Regeneration of skin’s barrier function after injury requires temporally coordinated cellular interactions between multiple cell types. Macrophages are essential inflammatory cells in skin wound regeneration. These cells switch their phenotype from inflammatory in the early regenerative stages to anti-inflammatory in the midstages of healing to coordinate skin repair. However, little is known about how different subsets of anti-inflammatory macrophages contribute to skin wound healing. Here, we characterize midstage macrophages (CD45+/CD11b+/F4-80+) and identify two major populations: CD206+/CD301b+ and CD206+/CD301b. The numbers of CD206+/CD301b+ macrophages increased concomitantly with repair, when the anti-inflammatory phenotype switch occurs in midstage healing. Using diphtheria toxin–mediated depletion models in mice, we show that selective depletion of midstage CD301b-expressing macrophages phenocopied wound healing defects observed in mice where multiple myeloid lineages are depleted. Additionally, when FACS-isolated subpopulations of myeloid cells were transplanted into 3-day wounds of syngeneic mice, only CD206+/CD301b+ macrophages significantly increased proliferation and fibroblast repopulation. These data show that the CD301b-expressing subpopulation of macrophages is critical for activation of reparative processes during the midstage of cutaneous repair.

      Abbreviations:

      DC (dendritic cell), DT (diphtheria toxin), DTR (diphtheria toxin receptor), EdU (5-ethynyl-2'-deoxyuridine), GFP (green fluorescent protein), iDTR (simian diphtheria toxin receptor), TGF (transforming growth factor)

      Introduction

      Restoration of skin after injury is essential for life and involves sequential regenerative phases involving immune, epithelial, and mesenchymal cells to reform the epidermis and its underlying supportive dermis. Early stage repair is defined by inflammation, wherein myeloid cells, including neutrophils and then macrophages, are recruited to the injury site to clear pathogens and debris (
      • Delavary B.M.
      • van der Veer W.M.
      • van Egmond M.
      • Niessen F.B.
      • Beelen R.H.J.
      Macrophages in skin injury and repair.
      ,
      • Eming S.A.
      • Krieg T.
      • Davidson J.M.
      Inflammation in wound repair: molecular and cellular mechanisms.
      ). The midstage of healing consists of a proliferative phase in which macrophages promote robust migration and proliferation of keratinocytes to reseal the epidermal barrier and dermal regeneration via fibroblast and blood vessel restoration (
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ,
      • Mirza R.
      • DiPietro L.A.
      • Koh T.J.
      Selective and specific macrophage ablation is detrimental to wound healing in mice.
      ). During late stage wound healing, newly regenerated tissue is pruned and remodeled to resemble the cellular arrangement of nonwounded tissue (
      • Brancato S.K.
      • Albina J.E.
      Wound macrophages as key regulators of repair.
      ,
      • Delavary B.M.
      • van der Veer W.M.
      • van Egmond M.
      • Niessen F.B.
      • Beelen R.H.J.
      Macrophages in skin injury and repair.
      ).
      The immune cell repertoire within skin wounds evolves with each repair stage and promotes distinct aspects of regeneration. After injury, CD11b+/F4-80+ macrophages are recruited to skin in a CCR2-dependent manner and express high levels of Ly6C (Ly6Chi) (
      • Ramachandran P.
      • Pellicoro A.
      • Vernon M.A.
      • Boulter L.
      • Aucott R.L.
      • Ali A.
      • et al.
      Differential Ly-6C expression identifies the recruited macrophage phenotype, which orchestrates the regression of murine liver fibrosis.
      ,
      • Rodero M.P.
      • Hodgson S.S.
      • Hollier B.
      • Combadiere C.
      • Khosrotehrani K.
      Reduced Il17a expression distinguishes a Ly6c.
      ,
      • Willenborg S.
      • Lucas T.
      • van Loo G.
      • Knipper J.A.
      • Krieg T.
      • Haase I.
      • et al.
      CCR2 recruits an inflammatory macrophage subpopulation critical for angiogenesis in tissue repair.
      ) and inflammatory cytokines (
      • Eming S.A.
      • Krieg T.
      • Davidson J.M.
      Inflammation in wound repair: molecular and cellular mechanisms.
      ,
      • Werner S.
      • Grose R.
      Regulation of wound healing by growth factors and cytokines.
      ). Early stage macrophages are similar to classically activated or the M1 macrophages described by others (
      • Brancato S.K.
      • Albina J.E.
      Wound macrophages as key regulators of repair.
      ,
      • Ferrante C.J.
      • Leibovich S.J.
      Regulation of macrophage polarization and wound healing.
      ). Throughout healing, macrophage phenotype changes as macrophage cell surface protein and cytokine messenger RNA expression changes (
      • Auffray C.
      • Sieweke M.H.
      • Geissmann F.
      Blood monocytes: development, heterogeneity, and relationship with dendritic cells.
      ,
      • Brancato S.K.
      • Albina J.E.
      Wound macrophages as key regulators of repair.
      ,
      • Ferrante C.J.
      • Leibovich S.J.
      Regulation of macrophage polarization and wound healing.
      ,
      • Mirza R.E.
      • Koh T.J.
      Contributions of cell subsets to cytokine production during normal and impaired wound healing.
      ). As regeneration proceeds into midstage healing, CD11b+/F4-80+/Ly6Chi macrophages decline, and the macrophage pool expresses mannose receptor (CD206), Fizz1, IL-10, transforming growth factor (TGF)-β1 and vascular endothelial growth factor (
      • Daley J.M.
      • Brancato S.K.
      • Thomay A.A.
      • Reichner J.S.
      • Albina J.E.
      The phenotype of murine wound macrophages.
      ,
      • Mirza R.E.
      • Koh T.J.
      Contributions of cell subsets to cytokine production during normal and impaired wound healing.
      ,
      • Werner S.
      • Grose R.
      Regulation of wound healing by growth factors and cytokines.
      ). These midstage macrophages, referred to as alternatively activated or M2 macrophages (
      • Gordon S.
      Alternative activation of macrophages.
      ,
      • Martinez F.O.
      • Sica A.
      • Mantovani A.
      • Locati M.
      Macrophage activation and polarization.
      ), mediate epithelial and dermal repair (
      • Delavary B.M.
      • van der Veer W.M.
      • van Egmond M.
      • Niessen F.B.
      • Beelen R.H.J.
      Macrophages in skin injury and repair.
      ,
      • Knipper J.A.
      • Willenborg S.
      • Brinckmann J.
      • Bloch W.
      • Maaß T.
      • Wagener R.
      • et al.
      Interleukin-4 receptor a signaling in myeloid cells controls collagen fibril assembly in skin repair.
      ,
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ). In the late phase of cutaneous repair, wound macrophages up-regulate metalloproteases to prune excess extracellular matrix to prevent scar formation (
      • Duffield J.S.
      • Forbes S.J.
      • Constandinou C.M.
      • Clay S.
      • Partolina M.
      • Vuthoori S.
      • et al.
      Selective depletion of macrophages reveals distinct, opposing roles during liver injury and repair.
      ). The progression of macrophage phenotype after injury suggests that multiple populations of myeloid cells likely regulate specific aspects of regeneration.
      Macrophages are essential for skin repair in adult mammals. Human chronic nonhealing venous leg ulcers or diabetic wounds in mice and humans display alterations in monocyte-derived cells (
      • Goren I.
      • Kämpfer H.
      • Podda M.
      • Pfeilschifter J.
      • Frank S.
      Leptin and wound inflammation in diabetic ob/ob mice: differential regulation of neutrophil and macrophage influx and a potential role for the scab as a sink for inflammatory cells and mediators.
      ,
      • Mirza R.E.
      • Fang M.M.
      • Ennis W.J.
      • Koh T.J.
      Blocking interleukin-1β induces a healing-associated wound macrophage phenotype and improves healing in type 2 diabetes.
      ,
      • Mirza R.
      • Koh T.J.
      Dysregulation of monocyte/macrophage phenotype in wounds of diabetic mice.
      ,
      • Wetzler C.
      • Kämpfer H.
      • Stallmeyer B.
      • Pfeilschifter J.
      • Frank S.
      Large and sustained induction of chemokines during impaired wound healing in the genetically diabetic mouse: prolonged persistence of neutrophils and macrophages during the late phase of repair.
      ). Furthermore, delayed healing in adult mice occurs when macrophages are depleted using anti-sera (
      • Leibovich S.J.
      • Ross R.
      The role of the macrophage in wound repair. A study with hydrocortisone and antimacrophage serum.
      ) or diphtheria toxin (DT)-induced death of monocyte-derived cells in genetic mouse models wherein DT receptor (DTR) is selectively expressed in these lineages (
      • Goren I.
      • Allmann N.
      • Yogev N.
      • Schürmann C.
      • Linke A.
      • Holdener M.
      • et al.
      A transgenic mouse model of inducible macrophage depletion.
      ,
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ,
      • Mirza R.
      • DiPietro L.A.
      • Koh T.J.
      Selective and specific macrophage ablation is detrimental to wound healing in mice.
      ). In the later experiments, DTR expression was induced by Cre recombinase activity under the Lysozyme M (LysM) promoter, which is expressed by monocytes, dendritic cells (DCs), and macrophages, or CD11b, which is expressed by macrophages and DCs (
      • Auffray C.
      • Sieweke M.H.
      • Geissmann F.
      Blood monocytes: development, heterogeneity, and relationship with dendritic cells.
      ,
      • Tamoutounour S.
      • Guilliams M.
      • Sanchis F.M.
      • Liu H.
      • Terhorst D.
      • Malosse C.
      • et al.
      Origins and functional specialization of macrophages and of conventional and monocyte-derived dendritic cells in mouse skin.
      ). Although these studies support the role of macrophages in skin repair, the precise cell type controlling skin regeneration within this heterogeneous and versatile lineage is not understood.
      Here, we investigated the contribution of specific macrophage subsets to reparative processes during skin regeneration by transplanting specific myeloid cells into skin wounds and depleting specific myeloid cells during wound healing in mice. Consistent with other groups (
      • Knipper J.A.
      • Willenborg S.
      • Brinckmann J.
      • Bloch W.
      • Maaß T.
      • Wagener R.
      • et al.
      Interleukin-4 receptor a signaling in myeloid cells controls collagen fibril assembly in skin repair.
      ,
      • Novak M.L.
      • Koh T.J.
      Macrophage phenotypes during tissue repair.
      ), we found that the macrophage phenotype switches from inflammatory to anti-inflammatory before re-epithelialization, fibroblast repopulation, and revascularization of skin wounds and that depleting midstage myeloid cells severely impairs multiple processes of cutaneous repair. Interestingly, we find that CD301b marks a portion of midphase macrophages and that depletion of CD301b-expressing macrophages is sufficient to phenocopy skin repair defects observed by depletion of myeloid cells more broadly. Transplanting CD301b+ macrophages is sufficient to enhance re-epithelialization, dermal proliferation, and fibroblast repopulation during midstage repair. Additionally, we showed that CD301b-expressing macrophage gene expression is enriched for growth factors and cytokines involved in skin regeneration. Therefore, our results identify a subset of CD301b+ macrophages critical for activating cutaneous repair during midstage wound healing.

      Results

      Altered macrophage phenotype precedes skin regeneration

      Because macrophage phenotype varies in different mouse backgrounds and wound paradigms, we sought to define the timing of myeloid cell plasticity compared with cutaneous regeneration after full-thickness excision of murine dorsal skin. We have previously shown in our wound paradigm that the early stage of healing in mice (1.5 days) corresponds to the inflammatory phase of injury (
      • Daley J.M.
      • Brancato S.K.
      • Thomay A.A.
      • Reichner J.S.
      • Albina J.E.
      The phenotype of murine wound macrophages.
      ,
      • Eming S.A.
      • Krieg T.
      • Davidson J.M.
      Inflammation in wound repair: molecular and cellular mechanisms.
      ), and that 3–5 days postinjury is the midstage or proliferative phase of repair when re-epithelialization, fibroblast repopulation, and revascularization occurs (
      • McGee H.M.
      • Schmidt B.A.
      • Booth C.J.
      • Yancopoulos G.D.
      • Valenzuela D.M.
      • Murphy A.J.
      • et al.
      IL-22 promotes fibroblast-mediated wound repair in the skin.
      ,
      • Schmidt B.A.
      • Horsley V.
      Intradermal adipocytes mediate fibroblast recruitment during skin wound healing.
      ) (see Supplementary Figure S1a and b online). Analysis of immune subsets showed that the number of viable macrophages (Sytox/CD45+/CD11b+/F4-80+) increased 5 and 7 days after wounding compared with 1.5- and 3-day wounds (Figure 1a–c).
      Figure 1
      Figure 1Macrophage phenotypic switch during cutaneous repair. (a, b) Representative FACS dot plots of (a) Sytox/CD45+ gating for analysis of CD11b+/F4-80+ macrophages (red box) in nonwounded and indicated time points after injury. (c) Quantification of b. (d) Representative FACS histogram of Ly6C and CD206 on wound bed macrophages. (e) Quantification of the percentage of Ly6Chi or CD206+ CD11b+/F4-80+ macrophages within wound beds at indicated time points. (f) Fold change in messenger RNA for cytokines in 1.5-day Ly6Chi wound macrophages (purple bar and line) versus 5-day CD206+ wound macrophages (red bar and line) macrophages. n = 3–4 mice for each time point. All data are mean ± standard error of the mean. P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001. d, day; NW, nonwounded.
      To assess broad macrophage classes in early versus midstage repair, we examined macrophage Ly6C and CD206 levels throughout healing using flow cytometry (Figure 1d). Although 1.5-day wounds were enriched for Ly6Chi macrophages, most 3-day wound macrophages were CD206+ (Figure 1e). The percentage of CD206+ macrophages remained high 5 and 7 days after injury, similar to nonwounded skin, and these macrophages were enriched for cytokines and growth factors that promote repair (Figure 1f). These data are consistent with previous studies (
      • Daley J.M.
      • Brancato S.K.
      • Thomay A.A.
      • Reichner J.S.
      • Albina J.E.
      The phenotype of murine wound macrophages.
      ,
      • Yin H.
      • Li X.
      • Hu S.
      • Liu T.
      • Yuan B.
      • Gu H.
      • et al.
      IL-33 accelerates cutaneous wound healing involved in upregulation of alternatively activated macrophages.
      ) and indicate that a wound bed macrophage phenotype switch precedes regeneration during the midstage of epidermal and dermal repair.

      Midstage myeloid cells are required for cutaneous repair

      To further examine the relationship between macrophage phenotype and cutaneous repair, we used a previously characterized mouse model that allows depletion of LysM-expressing myeloid cells (neutrophils, monocytes, and macrophages) through inducible expression of the simian diphtheria toxin receptor (iDTR) upon expression of Cre recombinase driven by the LysM promoter (LysMcre/iDTR mice) (
      • Buch T.
      • Heppner F.L.
      • Tertilt C.
      • Heinen T.J.A.J.
      • Kremer M.
      • Wunderlich F.T.
      • et al.
      A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration.
      ,
      • Clausen B.
      • Burkhardt C.
      • Reith W.
      • Renkawitz R.
      • Forster I.
      Conditional gene targeting in macrophages and granulocytes using LysMcre mice.
      ,
      • Goren I.
      • Allmann N.
      • Yogev N.
      • Schürmann C.
      • Linke A.
      • Holdener M.
      • et al.
      A transgenic mouse model of inducible macrophage depletion.
      ). After DT administration to mice at day 0 and 1 day after injury, we observed reduced CD11b+/F4-80+ wound macrophage numbers 3 days after injury in LysMcre/iDTR compared with control mice (Figure 2a and b).
      Figure 2
      Figure 2Midstage myeloid cells are necessary for wound healing. (a) FACS dot plots of CD11b+/F4-80+ cells in 3-day wound beds after diphtheria toxin administration immediately before and 1 day after injury. (b) Quantification of a. n = 4 mice for each time point. (c) Schematic illustrating experiments ablating myeloid cells continually and during the early (0–3 days after injury) and middle (3–7 days after injury) stages of skin repair. Orange arrows indicate diphtheria toxin injections. (d) Schematic illustration of an excisional wound bed. Quantification of (e) re-epithelialization, (f) phosphohistone H3+ cells, (g) relative fluorescence of ER-TR7 immunoreactivity and (h) wound bed area of CD31+ immunoreactivity in 7-day LysMcre/iDTR myeloid cell-depleted wound beds. n = 4 mice for each condition. All data are mean ± standard error of the mean. P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001. d, dermis; DT, diphtheria toxin; dwat, dermal white adipose tissue; e, epidermis; iDTR, simian diphtheria toxin receptor; IV, intravenous; pc, panniculus carnosis; s, scab; wb, wound bed.
      Similar to previous studies (
      • Goren I.
      • Allmann N.
      • Yogev N.
      • Schürmann C.
      • Linke A.
      • Holdener M.
      • et al.
      A transgenic mouse model of inducible macrophage depletion.
      ,
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ), continual depletion of LysM+ myeloid cells resulted in healing impairment at 7 days, as indicated by abrogation of re-epithelialization, proliferation, and fibroblast and blood vessel regeneration (Figure 2c–h and see Supplementary Figure S2a–c online). To explore whether myeloid cells function distinctly in early versus middle stage skin regeneration, we depleted LysM+ cells during the early and midstage healing process. Because myeloid cell numbers recover within 2 days of DT treatment, we targeted early stage myeloid cells with DT administration at day –0.5 and day 0.5 after injury. Midstage myeloid cells were targeted by DT administration 3, 4, and 6 days postinjury (Figure 2c). When LysM+ myeloid cells were depleted during early stage wound healing, the ensuing 7-day wound beds appeared histologically similar to control wounds because re-epithelialization, proliferation, and revascularization were similar to control wound beds; however, we observed a reduction in ER-TR7+ fibroblast regeneration (Figure 2c–h and see Supplementary Figure S2a–c). This slight difference in early wound bed phenotype compared with that reported in previous studies (
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ) may reflect differences in wounding and DT administration paradigms. In contrast, depleting LysM+ myeloid cells during the midstage of healing resulted in poorly healed wounds with defects in re-epithelialization, proliferation, fibroblast regeneration, and revascularization (Figure 2c–h and see Supplementary Figure S2a–c). Overall, these data confirm previous work that midstage myeloid cells are required for multiple reparative processes (
      • Goren I.
      • Allmann N.
      • Yogev N.
      • Schürmann C.
      • Linke A.
      • Holdener M.
      • et al.
      A transgenic mouse model of inducible macrophage depletion.
      ,
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ,
      • Mirza R.
      • DiPietro L.A.
      • Koh T.J.
      Selective and specific macrophage ablation is detrimental to wound healing in mice.
      ).

      Midstage myeloid cells enhance dermal repair

      To determine if a low number of myeloid cells from midstage wounds can enhance cutaneous repair, we transplanted 30,000 LysM+ myeloid cells into 3-day wounds and analyzed regeneration 5 days after injury. LysM+ myeloid cells were isolated from LysMcre;mT/mG mice in which LysMcre mediated a heritable switch from membrane-bound td-Tomato to membrane-bound green fluorescent protein (GFP) expression (mT/mG) (
      • Muzumdar M.D.
      • Tasic B.
      • Miyamichi K.
      • Li L.
      • Luo L.
      A global double-fluorescent Cre reporter mouse.
      ) (see Supplementary Figure S3a online). Because we observed skin repair peaking 5 days after injury (see Supplementary Figure S1a and b), we isolated GFP+ (myeloid cells) and Tomato+ (nonmyeloid cells) cells from 5-day wound beds (see Supplementary Figure S3a); injected them into 3-day wound beds of mT/mG-negative, syngeneic littermates; and harvested tissue 5 days after injury. To examine proliferation during repair, 5-ethynyl-2'-deoxyuridine (EdU) was administered to mice on days 3 and 4 postinjury (see Supplementary Figure S3a). Transplanted cells persisted 2 days after injection (see Supplementary Figure S3b). Wounds from mice injected with myeloid cells did not show enhanced re-epithelialization but contained a greater percentage of EdU-incorporating cells, increased numbers of phosphorylated histone (pH3)+ cells/mm2, increased ER-TR7+ fibroblast repopulation, and blood vessel formation in wounds transplanted with myeloid cells compared with nonmyeloid cells (see Supplementary Figure S3c–g), showing that midstage myeloid cells promoted wound bed proliferation, fibroblast repopulation, and revascularization. Collectively, these data indicate that midstage myeloid cells are capable of promoting reparative processes in dermal repair.

      Macrophage heterogeneity during the midstage of wound healing

      LysMcre displays Cre activity in several myeloid cell types (
      • Clausen B.
      • Burkhardt C.
      • Reith W.
      • Renkawitz R.
      • Forster I.
      Conditional gene targeting in macrophages and granulocytes using LysMcre mice.
      ,
      • Goren I.
      • Allmann N.
      • Yogev N.
      • Schürmann C.
      • Linke A.
      • Holdener M.
      • et al.
      A transgenic mouse model of inducible macrophage depletion.
      ) and thus does not define a specific macrophage subtype. We hypothesized that a specific macrophage subclass functions to support regeneration during midstage repair. To examine macrophage heterogeneity during wound healing, we analyzed the expression of CD206, which is expressed by midstage macrophages in skin wounds (
      • Daley J.M.
      • Brancato S.K.
      • Thomay A.A.
      • Reichner J.S.
      • Albina J.E.
      The phenotype of murine wound macrophages.
      ,
      • Mirza R.
      • Koh T.J.
      Dysregulation of monocyte/macrophage phenotype in wounds of diabetic mice.
      ), and CD301b, also expressed by M2 macrophages (
      • Raes G.
      Macrophage galactose-type C-type lectins as novel markers for alternatively activated macrophages elicited by parasitic infections and allergic airway inflammation.
      ) (Figure 3a). Although most CD11b+/F4-80+ macrophages express both CD206+ and CD301b+ in uninjured skin, relatively few macrophages have cell surface expression of both proteins in 1.5-day wounds. At this early stage of repair, approximately 40% of CD206+ macrophages present in wound beds express CD301b (Figure 3b). During midstage healing, the percentage of CD11b+/F4-80+ macrophages expressing CD206 and CD301b increases (Figure 3a and b); 3 days postinjury, 50% of CD11b+/F4-80+/CD206+ macrophages express CD301b, and this percentage increases to approximately 80% 5 days after injury (Figure 3a and b and see Supplementary Figure S4a and b online). These data indicate that macrophages are heterogeneous in vivo during wound healing and show that CD301b expression increases as macrophage phenotype changes during midphase skin regeneration.
      Figure 3
      Figure 3CD301b-expressing macrophages are required for skin repair. (a) Representative FACS dot plots of Sytox/CD11b+/F4-80+ cells for CD301b and CD206 throughout healing. (b) Quantification of the percentage of CD301b (red) or CD301b+ (purple) (CD11b+/F4-80+/CD206+) macrophages. n = 3 mice for each bar. (c) Representative FACS histogram and quantification of CD301b+ cells in 5-day wounds in diphtheria toxin-treated Mgl2DTR/GFP and control mice. n = 3 mice for each condition. (d) Images of 7-day wounds immunostained for ER-TR7, α-smooth muscle actin, and CD31. (e) Quantification of ER-TR7 corrected total fluorescence, re-epithelialization (re-epi), and wound bed area containing CD31 fluorescence in diphtheria toxin-treated Mgl2DTR/GFP and control wounds. n = 5 mice for each condition. Scale bar = 250 μm. White lines delineate wound edges. All data are mean ± standard error of the mean. P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001. Ctrl, control; d, day; DT, diphtheria toxin; Max, maximum; NW, nonwounded; re-epi, re-epithelialization; Sac, sacrifice.

      CD301b+ macrophages are necessary for skin repair

      To examine the contribution of CD301b+ cells to skin regeneration, we depleted CD301b+ cells during repair using mice expressing a DTR/GFP fusion protein under the endogenous CD301b promoter (macrophage galactose-type C-type lectin 2 or Mgl2)(Mgl2DTR/GFP). This mouse model has been used to successfully deplete dermal CD301b-expressing cells with high efficiency (
      • Kumamoto Y.
      • Linehan M.
      • Weinstein J.S.
      • Laidlaw B.J.
      • Craft J.E.
      • Iwasaki A.
      CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.
      ). We observed a complete ablation of GFP+ cells in wound beds 1 day after DT injection to Mgl2DTR/GFP mice (see Supplementary Figure S4c and d), with a reduced number of CD301b+ cells 2 days after injection (Figure 3c). CD206+ macrophages were still abundant in wounds of DT-treated Mgl2DTR mice (see Supplementary Figure S4e).
      To determine if CD301b+ macrophages contribute to midstage skin regeneration, we depleted CD301b+ cells 3 days after injury in Mgl2DTR/GFP mice and examined wound beds after 5 and 7 days (Figure 3c). Immunostaining of skin sections with antibodies against ER-TR7 and α-smooth muscle actin showed defects in fibroblast/myofibroblast repopulation in 5- and 7-day wound beds of DT-treated Mgl2DTR/GFP mice (Figure 3d and e). We also detected decreases in re-epithelialization, EdU incorporation, and revascularization in DT-treated Mgl2DTR/GFP mice (Figure 3d and e and see Supplementary Figure S4f). These healing defects phenocopy LysMcre mice treated with DT during midstage healing (Figure 2c–h) and indicate that CD301b+ cells are a specific subset of cells that contribute to skin regeneration.

      CD301b+ macrophages enhance skin regeneration

      Since transplanting myeloid cells from 5-day wounds into 3-day recipient wound beds increased fibroblast and vascular regeneration (see Supplementary Figure S3), we determined if a low number of CD301b+ macrophages could stimulate a similar effect. We used FACS to isolate cellular subsets from 5-day wounds for cell transplantation into 3-day wound beds and examined the contribution of four cell populations to repair in syngeneic littermate control animals: nonimmune stromal cells (CD45) as a control, monocytes (CD45+/CD11b+/F4-80-), CD206+/CD301b- macrophages, and CD206+/CD301b+ macrophages. EdU was administered on days 3 and 4 after injury, and wounds were examined at day 5 (Figure 4a). Strikingly, we detected an increase in re-epithelialization, EdU+ incorporating cells, mitotic pH3+ cells/mm2, and relative fluorescence of ER-TR7+ fibroblasts in wounds injected with CD206+/CD301b+ macrophages compared with vehicle control and CD206+/CD301b macrophages (Figure 4b and c); however, we did not detect a statistically significant change in revascularization.
      Figure 4
      Figure 4CD301b-expressing macrophages enhance dermal repair. (a) Hierarchical gating strategy used to FACS sort 5-day wound bed cells for transplantation into 3-day syngeneic littermates. (b) Representative images of EdU+, pH3+, and ER-TR7+ cells in the middle of 5-day wound beds of mice that were transplanted with vehicle, CD206+/CD301b+, or CD206+/CD301b macrophages. (c) Quantification of re-epithelialization, EdU+, and pH3+ cells per mm2, ER-TR7 corrected total fluorescence, and wound bed area containing CD31 fluorescence in 5-day wound beds transplanted with indicated cell types. (d) Real-time PCR analysis of messenger RNA in CD206+/CD301b+ macrophages 5 days after wounding. Red line indicates gene expression in total wound bed. n = 3 mice for each bar. Scale bar = 200 μm. All data are mean ± standard error of the mean. P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001. ns, not significant.
      To determine if CD301b+/CD206+ macrophages express cytokines that facilitate epidermal and/or dermal repair, we examined messenger RNA levels in CD206+ and CD301b+ macrophages. We find that CD206+/CD301b+ macrophages express increased levels of IL10, Pdgfβ, and Tgfβ1 compared with the stromal vascular fraction and did not express Fgf7 or Tgfβ3, which are growth factors produced by wound bed fibroblasts (Figure 4d). Taken together, these results implicate CD301b-expressing macrophages as a key cell type responsible for activating reparative processes during skin wound healing.

      Discussion

      Our data show that a specific class of myeloid cells, CD301b+ macrophages, is essential for midstage healing of skin after injury. This conclusion is based on major defects in cutaneous repair (re-epithelialization, angiogenesis, and fibroblast regeneration) when CD301b-expressing macrophages are depleted during midstage repair. This dysfunctional regeneration phenocopies defects observed when the myeloid lineage is ablated more broadly during midphase skin regeneration using LysMcre and CD11bcre (
      • Goren I.
      • Allmann N.
      • Yogev N.
      • Schürmann C.
      • Linke A.
      • Holdener M.
      • et al.
      A transgenic mouse model of inducible macrophage depletion.
      ,
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ,
      • Mirza R.
      • DiPietro L.A.
      • Koh T.J.
      Selective and specific macrophage ablation is detrimental to wound healing in mice.
      ). In addition, we also show that transplantation of CD11b+/F4-80+/CD301b+ cells, but not CD301b cells, promotes proliferation of cells in the wound bed and fibroblast recruitment to skin wounds during midphase repair. We only observed increased re-epithelialization after injection of CD301b+ macrophages and not total myeloid cells, showing the enriched regenerative potential of this macrophage subset. Because the proportion of CD301b+ cells increased during midstage healing, our data show that CD301b+ macrophages coordinate midstage skin regeneration after injury.
      Although CD301b is expressed by a subset of dermal DCs (CD11b+ cells), where it participates in the uptake of N-acetylgalactosamine residues (
      • Kawakami K.
      • Yamamoto K.
      • Toyoshima S.
      • Osawa T.
      • Irimura T.
      Dual function of macrophage galactose/N-acetylgalactosamine-specific lectins: glycoprotein uptake and tumoricidal cellular recognition.
      ), and DT treatment of Mgl2DTR/GFP mice has been shown to deplete CD11b+ DCs and Langerhans cells (
      • Kumamoto Y.
      • Linehan M.
      • Weinstein J.S.
      • Laidlaw B.J.
      • Craft J.E.
      • Iwasaki A.
      CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.
      ), we hypothesize that CD301b+ macrophages are the primary myeloid cell type involved in coordinating midstage regeneration in skin after injury. Because we did not observe significant numbers of CD11b+/F4-80/MHCII+/CD301b+ DCs in skin wound beds during the early or midstages of repair (not shown), we hypothesize the more prevalent CD11b+/F4-80+/CD206+/CD301b+ macrophage population is the key cell type involved in midstage wound repair. Consistent with this hypothesis, transplantation of CD11b+/F4-80+/CD301b+ cells is sufficient to enhance re-epithelialization, dermal proliferation, and fibroblast recruitment similar to transplantation of total myeloid cells, suggesting that these are essential cells that coordinate midstage skin repair. Finally, our data show that CD301b+ macrophages express several cytokines including IL-10, platelet-derived growth factor–β and TGF-β1 that mediate regeneration during skin wound healing (
      • Brancato S.K.
      • Albina J.E.
      Wound macrophages as key regulators of repair.
      ,
      • Knipper J.A.
      • Willenborg S.
      • Brinckmann J.
      • Bloch W.
      • Maaß T.
      • Wagener R.
      • et al.
      Interleukin-4 receptor a signaling in myeloid cells controls collagen fibril assembly in skin repair.
      ,
      • Werner S.
      • Grose R.
      Regulation of wound healing by growth factors and cytokines.
      ). Future studies exploring whether specific DC subsets or Langerhans cells function in cutaneous repair and additional studies examining additional heterogeneity within CD301b+ macrophages during skin healing will be of great interest.
      The nature of the myeloid cell plasticity during tissue repair is not clear (
      • Gordon S.
      • Taylor P.R.
      Monocyte and macrophage heterogeneity.
      ,
      • Novak M.L.
      • Koh T.J.
      Macrophage phenotypes during tissue repair.
      ). Our data and those of others (
      • Daley J.M.
      • Brancato S.K.
      • Thomay A.A.
      • Reichner J.S.
      • Albina J.E.
      The phenotype of murine wound macrophages.
      ,
      • Lucas T.
      • Waisman A.
      • Ranjan R.
      • Roes J.
      • Krieg T.
      • Muller W.
      • et al.
      Differential roles of macrophages in diverse phases of skin repair.
      ,
      • Willenborg S.
      • Lucas T.
      • van Loo G.
      • Knipper J.A.
      • Krieg T.
      • Haase I.
      • et al.
      CCR2 recruits an inflammatory macrophage subpopulation critical for angiogenesis in tissue repair.
      ) show that myeloid cells display distinct phenotypes during repair, yet how these phenotypes are generated is poorly understood. It is possible that CD301b+ cells are formed from myeloid cells resident in skin or derived from circulating myeloid cells in a CCR2-dependent manner. Because CD206+ macrophages are abundant in skin wounds of DT-treated Mgl2DTR/GFP mice, CD301b expression may indicate a maturation of CD206+ cells during skin regeneration. Because Mgl2 (CD301b) expression is downstream of signal transducer and activator of transcription-6 activation in response to IL-4 or IL-13 stimulation (
      • Raes G.
      Macrophage galactose-type C-type lectins as novel markers for alternatively activated macrophages elicited by parasitic infections and allergic airway inflammation.
      ), it is possible that CD206+/CD301b+ macrophages represent recently described macrophages that control collagen fibril assembly during skin regeneration (
      • Knipper J.A.
      • Willenborg S.
      • Brinckmann J.
      • Bloch W.
      • Maaß T.
      • Wagener R.
      • et al.
      Interleukin-4 receptor a signaling in myeloid cells controls collagen fibril assembly in skin repair.
      ); however, because anti-inflammatory macrophages exist in IL-4 receptor knock-out mice (
      • Daley J.M.
      • Brancato S.K.
      • Thomay A.A.
      • Reichner J.S.
      • Albina J.E.
      The phenotype of murine wound macrophages.
      ,
      • Ferrante C.J.
      • Pinhal-Enfield G.
      • Elson G.
      • Cronstein B.N.
      • Hasko G.
      • Outram S.
      • et al.
      The adenosine-dependent angiogenic switch of macrophages to an M2-like phenotype is independent of interleukin-4 receptor alpha (IL-4Rα) signaling.
      ), Mgl2 activation could be independent of IL-4 receptor signaling or other regenerative macrophage populations could exist during skin wound healing. Future studies using lineage tracing of myeloid cells during skin injury may show lineage relationships between subsets of myeloid cells.
      In summary, our data identify a specific “pro-healing” myeloid cell population that functions during cutaneous repair. Further study of CD301b+ macrophages may reveal molecular mechanisms by which myeloid cells function in tissue repair. Furthermore, induction of obesity and/or diabetes (
      • Seitz O.
      • Schürmann C.
      • Hermes N.
      • Müller E.
      • Pfeilschifter J.
      • Frank S.
      • et al.
      Wound healing in mice with high-fat diet- or ob gene-induced diabetes-obesity syndromes: a comparative study.
      ) in Mgl2DTR/GFP mice will allow the investigation of how this myeloid subset contributes to diabetes-impaired skin repair, which displays defects in myeloid cells (
      • Mirza R.
      • Koh T.J.
      Dysregulation of monocyte/macrophage phenotype in wounds of diabetic mice.
      ,
      • Mirza R.E.
      • Koh T.J.
      Contributions of cell subsets to cytokine production during normal and impaired wound healing.
      ,
      • Mirza R.E.
      • Fang M.M.
      • Ennis W.J.
      • Koh T.J.
      Blocking interleukin-1β induces a healing-associated wound macrophage phenotype and improves healing in type 2 diabetes.
      ). Finally, because myeloid cells function in multiple tissues to control regeneration after injury, our identification of a role of CD301b+ myeloid cells in skin repair may have broad implications for regeneration of many tissue types.

      Materials and Methods

      Mice

      All animal care and experiments followed guidelines issued by Yale University’s Institutional Animal Care and Use Committee. C57/Bl6 mice were purchased from Charles River, and previously described LysMcre (stock #004781), iDTR (stock #007900), and mT/mG (stock #007676) were purchase from Jackson Laboratories (Bar Harbor, ME). Mgl2DTR/GFP mice were developed by the laboratory of A. Iwasaki (Yale University, New Haven, CT) (
      • Kumamoto Y.
      • Linehan M.
      • Weinstein J.S.
      • Laidlaw B.J.
      • Craft J.E.
      • Iwasaki A.
      CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.
      ). For wounding studies, 7–9-week-old male mice were used during the telogen phase of hair cycling. Mice were anesthetized with isofluorane, and four or six full-thickness wounds, 3–4 mm apart, were made on shaved dorsal skin using a 4-mm biopsy punch (Accuderm, Ft. Lauderdale, FL). For EdU experiments, 50 mg/kg of EdU (Invitrogen, Waltham, MA) was injected intraperitoneally at indicated time points and detected per the manufacturer’s protocol. To genetically deplete myeloid cells, LysMcre/iDTR mice were given 50 μl of 20 ng/μl DT (Sigma, St. Louis, MO) via tail vein injection. To deplete CD301b-expressing cells, 25 μl of 20 ng/μl DT was administered intraperitoneally to Mgl2DTR/GFP mice.

      Immunofluorescence and morphometric analysis

      Wound beds were mounted in optimum cutting temperature compound (Tissue-Tek, Sakura Finetek USA, Torrance, CA) and sectioned through their entirety to identify the center of the wound bed. Next, 14-μm cryosections were fixed with 4% formaldehyde and immunostained as previously described (
      • Festa E.
      • Fretz J.
      • Berry R.
      • Schmidt B.
      • Rodeheffer M.
      • Horowitz M.
      • et al.
      Adipocyte lineage cells contribute to the skin stem cell niche to drive hair cycling.
      ,
      • McGee H.M.
      • Schmidt B.A.
      • Booth C.J.
      • Yancopoulos G.D.
      • Valenzuela D.M.
      • Murphy A.J.
      • et al.
      IL-22 promotes fibroblast-mediated wound repair in the skin.
      ) using the following antibodies: CD31 (rat, 1:100; BD Biosciences, Franklin Lakes, NJ,), CD206 (rat, 1:500; Biolegend, San Diego, CA), CD301b (rat 1:200; eBioscience, San Diego, CA), ER-TR7 (rat, 1:500; Abcam, Cambridge, UK), GFP (chicken, 1:1,000; Abcam,), and phosphohistone H3 (rabbit, 1:500; Abcam). Histological quantification for each wound bed was conducted on the three central-most sections, and the averages from two wounds were averaged for each animal. Re-epithelialization and corrected total fluorescence were calculated using ImageJ software (National Institutes of Health, Bethesda, MD) as described previously (
      • McGee H.M.
      • Schmidt B.A.
      • Booth C.J.
      • Yancopoulos G.D.
      • Valenzuela D.M.
      • Murphy A.J.
      • et al.
      IL-22 promotes fibroblast-mediated wound repair in the skin.
      ,
      • Schmidt B.A.
      • Horsley V.
      Intradermal adipocytes mediate fibroblast recruitment during skin wound healing.
      ). Revascularization was calculated using Adobe Photoshop to measure the total CD31+ pixels divided by the total number of pixels in wound beds.

      Fluorescence-activated cell sorting and analysis

      Mouse back skin and wound beds were dissected and digested into single cells using 1:100 collagenase 1A (Worthington, Lakewood, NJ), as previously described (
      • Festa E.
      • Fretz J.
      • Berry R.
      • Schmidt B.
      • Rodeheffer M.
      • Horowitz M.
      • et al.
      Adipocyte lineage cells contribute to the skin stem cell niche to drive hair cycling.
      ,
      • Schmidt B.A.
      • Horsley V.
      Intradermal adipocytes mediate fibroblast recruitment during skin wound healing.
      ). Single-cell suspensions were resuspended in FACS staining buffer (1% BSA in phosphate buffered saline with 2 mmol/L EDTA) and stained with the following antibodies for 30 minutes on ice: CD45-APC-eFluor780 (1:2,000; eBioscience,), CD11b-Alexa700 (1:500; eBioscience), F4-80-eFluor450 (1:50; eBioscience), CD206-Alexa488 (1:500; Biolegend), CD301b-Alexa660 (1:100; eBioscience), Ly6C-APC (1:250; eBioscience). Wound macrophages were defined as CD45+/CD11b+/F4-80+ cells. Sytox Orange (1:100,000; Invitrogen) was added immediately before sorting with a FACS Aria III with FACS DiVA software (BD Biosciences). Flow cytometry analysis was performed using FlowJo Software (FlowJo, Ashland, OR).

      Real-Time PCR

      For quantitative real-time PCR, samples were FACS purified directly into TRIzol LS (Invitrogen), RNA was extracted, and complementary DNA was generated using Superscript III Reverse Transcriptase (Thermo Fisher, Waltham, MA) per the manufacturer’s instructions. Primers (5′–3′, forward and reverse): CD206, CAAGGAAGGTTGGCATTTGT and CCTTTCAGTCCTTTGCAAGC; CD301b, GACTGAGTTCTCGCCTCTGG and CTGGGAAGGAATTAGAGCAAACT; IL10, GCCCAGAAATCAAGGAGCATT and TGCTCCACTGCCTTGCTCTTA; Pdgfβ, CCCTGTGTGGAGGTGCAGCG and GACACGGCCCAGGTCACACG; Tgfβ1, ACGCCTGAGTGGCTGTCTTTTGAC and GGGCTGATCCCGTTGATTTCCACG; Tgfβ3, CGTTTCAATGTGTCCTCAGTGGAG and AAGAGCTCAATTCTCTGCTCTGTG; Fgf7, AGCGGAGGGGAAATGTTCG and TCCAGCCTTTCTTGGTTACTGAGA; and β-actin, ATCAAGATCATTGCTCCTCCTGAG and CTGCTTGCTGATCCACATCTG. All quantitative real-time PCR was performed using SYBR green on a LightCycler 480 (Roche, Basel, Switzerland) and normalized to β-actin as previously described (
      • Festa E.
      • Fretz J.
      • Berry R.
      • Schmidt B.
      • Rodeheffer M.
      • Horowitz M.
      • et al.
      Adipocyte lineage cells contribute to the skin stem cell niche to drive hair cycling.
      ).

      Cell transplants

      For transplanting cells into wounds, cell populations were FACS purified, counted using a hemocytometer, and diluted in FACS staining buffer at a concentration of 3.0 × 106 cells/ml. 10 μl of cell suspension (30,000 cells) was slowly injected into wound beds of anesthetized mice using a 30-guage needle.

      Statistics

      To determine significance between two groups, comparisons were made using Student t test. Analyses across multiple groups were made using a one-way analysis of variance with Bonferroni’s post hoc test using GraphPad Prism for Mac (GraphPad Software, La Jolla, CA) with significance set at P < 0.05.

      Conflict of Interest

      The authors state no conflict of interest.

      Acknowledgments

      We thank VH’s lab members for technical assistance, critically reading the manuscript, and discussions. VH is funded by the National Institutes of Health (AR060295) and Connecticut Department of Public Health (12SCBYALE01). BS is a New York Stem Cell Foundation–Druckenmiller Fellow. This research was supported by the New York Stem Cell Foundation.

      Supplementary Material

      References

        • Auffray C.
        • Sieweke M.H.
        • Geissmann F.
        Blood monocytes: development, heterogeneity, and relationship with dendritic cells.
        Annu Rev Immunol. 2009; 27: 669-692
        • Brancato S.K.
        • Albina J.E.
        Wound macrophages as key regulators of repair.
        Am J Pathol. 2011; 178: 19-25
        • Buch T.
        • Heppner F.L.
        • Tertilt C.
        • Heinen T.J.A.J.
        • Kremer M.
        • Wunderlich F.T.
        • et al.
        A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration.
        Nat Methods. 2005; 2: 419-426
        • Clausen B.
        • Burkhardt C.
        • Reith W.
        • Renkawitz R.
        • Forster I.
        Conditional gene targeting in macrophages and granulocytes using LysMcre mice.
        Transgenic Res. 1999; 8: 265-277
        • Daley J.M.
        • Brancato S.K.
        • Thomay A.A.
        • Reichner J.S.
        • Albina J.E.
        The phenotype of murine wound macrophages.
        J Leukoc Biol. 2010; 87: 59-67
        • Delavary B.M.
        • van der Veer W.M.
        • van Egmond M.
        • Niessen F.B.
        • Beelen R.H.J.
        Macrophages in skin injury and repair.
        Immunobiology. 2011; 216: 753-762
        • Duffield J.S.
        • Forbes S.J.
        • Constandinou C.M.
        • Clay S.
        • Partolina M.
        • Vuthoori S.
        • et al.
        Selective depletion of macrophages reveals distinct, opposing roles during liver injury and repair.
        J Clin Invest. 2005; 115: 56-65
        • Eming S.A.
        • Krieg T.
        • Davidson J.M.
        Inflammation in wound repair: molecular and cellular mechanisms.
        J Invest Dermatol. 2007; 127: 514-525
        • Ferrante C.J.
        • Leibovich S.J.
        Regulation of macrophage polarization and wound healing.
        Adv Wound Care. 2012; 1: 10-16
        • Ferrante C.J.
        • Pinhal-Enfield G.
        • Elson G.
        • Cronstein B.N.
        • Hasko G.
        • Outram S.
        • et al.
        The adenosine-dependent angiogenic switch of macrophages to an M2-like phenotype is independent of interleukin-4 receptor alpha (IL-4Rα) signaling.
        Inflammation. 2013; 36: 921-931
        • Festa E.
        • Fretz J.
        • Berry R.
        • Schmidt B.
        • Rodeheffer M.
        • Horowitz M.
        • et al.
        Adipocyte lineage cells contribute to the skin stem cell niche to drive hair cycling.
        Cell. 2011; 146: 761-771
        • Gordon S.
        Alternative activation of macrophages.
        Nat Rev Immunol. 2003; 3: 23-35
        • Gordon S.
        • Taylor P.R.
        Monocyte and macrophage heterogeneity.
        Nat Rev Immunol. 2005; 5: 953-964
        • Goren I.
        • Allmann N.
        • Yogev N.
        • Schürmann C.
        • Linke A.
        • Holdener M.
        • et al.
        A transgenic mouse model of inducible macrophage depletion.
        Am J Pathol. 2010; 175: 132-147
        • Goren I.
        • Kämpfer H.
        • Podda M.
        • Pfeilschifter J.
        • Frank S.
        Leptin and wound inflammation in diabetic ob/ob mice: differential regulation of neutrophil and macrophage influx and a potential role for the scab as a sink for inflammatory cells and mediators.
        Diabetes. 2003; 52: 2821-2832
        • Kawakami K.
        • Yamamoto K.
        • Toyoshima S.
        • Osawa T.
        • Irimura T.
        Dual function of macrophage galactose/N-acetylgalactosamine-specific lectins: glycoprotein uptake and tumoricidal cellular recognition.
        Jpn J Cancer Res. 1994; 85: 744-749
        • Knipper J.A.
        • Willenborg S.
        • Brinckmann J.
        • Bloch W.
        • Maaß T.
        • Wagener R.
        • et al.
        Interleukin-4 receptor a signaling in myeloid cells controls collagen fibril assembly in skin repair.
        Immunity. 2015; 43: 803-816
        • Kumamoto Y.
        • Linehan M.
        • Weinstein J.S.
        • Laidlaw B.J.
        • Craft J.E.
        • Iwasaki A.
        CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.
        Immunity. 2013; 39: 733-743
        • Leibovich S.J.
        • Ross R.
        The role of the macrophage in wound repair. A study with hydrocortisone and antimacrophage serum.
        Am J Pathol. 1975; 78: 71-100
        • Lucas T.
        • Waisman A.
        • Ranjan R.
        • Roes J.
        • Krieg T.
        • Muller W.
        • et al.
        Differential roles of macrophages in diverse phases of skin repair.
        J Immunol. 2010; 184: 3964-3977
        • Martinez F.O.
        • Sica A.
        • Mantovani A.
        • Locati M.
        Macrophage activation and polarization.
        Front Biosci. 2008; 13: 453-461
        • McGee H.M.
        • Schmidt B.A.
        • Booth C.J.
        • Yancopoulos G.D.
        • Valenzuela D.M.
        • Murphy A.J.
        • et al.
        IL-22 promotes fibroblast-mediated wound repair in the skin.
        J Invest Dermatol. 2012; 133: 1321-1329
        • Mirza R.
        • DiPietro L.A.
        • Koh T.J.
        Selective and specific macrophage ablation is detrimental to wound healing in mice.
        Am J Pathol. 2010; 175: 2454-2462
        • Mirza R.E.
        • Fang M.M.
        • Ennis W.J.
        • Koh T.J.
        Blocking interleukin-1β induces a healing-associated wound macrophage phenotype and improves healing in type 2 diabetes.
        Diabetes. 2013; 62: 2579-2587
        • Mirza R.
        • Koh T.J.
        Dysregulation of monocyte/macrophage phenotype in wounds of diabetic mice.
        Cytokine. 2011; 56: 256-264
        • Mirza R.E.
        • Koh T.J.
        Contributions of cell subsets to cytokine production during normal and impaired wound healing.
        Cytokine. 2014; 71: 409-412
        • Muzumdar M.D.
        • Tasic B.
        • Miyamichi K.
        • Li L.
        • Luo L.
        A global double-fluorescent Cre reporter mouse.
        Genesis. 2007; 45: 593-605
        • Novak M.L.
        • Koh T.J.
        Macrophage phenotypes during tissue repair.
        J Leukoc Biol. 2013; 93: 875-881
        • Raes G.
        Macrophage galactose-type C-type lectins as novel markers for alternatively activated macrophages elicited by parasitic infections and allergic airway inflammation.
        J Leukoc Biol. 2004; 77: 321-327
        • Ramachandran P.
        • Pellicoro A.
        • Vernon M.A.
        • Boulter L.
        • Aucott R.L.
        • Ali A.
        • et al.
        Differential Ly-6C expression identifies the recruited macrophage phenotype, which orchestrates the regression of murine liver fibrosis.
        Proc Natl Acad Sci USA. 2012; 109: E3186-E3195
        • Rodero M.P.
        • Hodgson S.S.
        • Hollier B.
        • Combadiere C.
        • Khosrotehrani K.
        Reduced Il17a expression distinguishes a Ly6c.
        J Invest Dermatol. 2012; 133: 783-792
        • Schmidt B.A.
        • Horsley V.
        Intradermal adipocytes mediate fibroblast recruitment during skin wound healing.
        Development. 2013; 140: 1517-1527
        • Seitz O.
        • Schürmann C.
        • Hermes N.
        • Müller E.
        • Pfeilschifter J.
        • Frank S.
        • et al.
        Wound healing in mice with high-fat diet- or ob gene-induced diabetes-obesity syndromes: a comparative study.
        Exp Diabetes Res. 2010; 2010: 476969
        • Tamoutounour S.
        • Guilliams M.
        • Sanchis F.M.
        • Liu H.
        • Terhorst D.
        • Malosse C.
        • et al.
        Origins and functional specialization of macrophages and of conventional and monocyte-derived dendritic cells in mouse skin.
        Immunity. 2013; 39: 925-938
        • Werner S.
        • Grose R.
        Regulation of wound healing by growth factors and cytokines.
        Physiol Rev. 2003; 83: 835-870
        • Wetzler C.
        • Kämpfer H.
        • Stallmeyer B.
        • Pfeilschifter J.
        • Frank S.
        Large and sustained induction of chemokines during impaired wound healing in the genetically diabetic mouse: prolonged persistence of neutrophils and macrophages during the late phase of repair.
        J Invest Dermatol. 2000; 115: 245-253
        • Willenborg S.
        • Lucas T.
        • van Loo G.
        • Knipper J.A.
        • Krieg T.
        • Haase I.
        • et al.
        CCR2 recruits an inflammatory macrophage subpopulation critical for angiogenesis in tissue repair.
        Blood. 2012; 120: 613-625
        • Yin H.
        • Li X.
        • Hu S.
        • Liu T.
        • Yuan B.
        • Gu H.
        • et al.
        IL-33 accelerates cutaneous wound healing involved in upregulation of alternatively activated macrophages.
        Mol Immunol. 2013; 56: 347-353