Advertisement

miR-29 Regulates Type VII Collagen in Recessive Dystrophic Epidermolysis Bullosa

Open ArchivePublished:June 17, 2016DOI:https://doi.org/10.1016/j.jid.2016.05.115
      Recessive dystrophic epidermolysis bullosa (RDEB) is a complex inherited skin disorder caused by loss-of-function mutations in the COL7A1 gene. For an effective treatment of this disorder to be realized, both a thorough understanding of the regulation of COL7A1 and an understanding of the underlying nature of the complications of RDEB are needed. Currently, both posttranscriptional regulation of COL7A1 and the underlying causes of fibrosis in RDEB patients are poorly understood. Here, we describe a mechanism of regulation, to our knowledge previously unknown, by which micro RNA-29 (miR-29) regulates COL7A1 in a complex network: both directly through targeting its 3′ untranslated region at two distinct seed regions and indirectly through targeting an essential transcription factor required for basal COL7A1 expression, SP1. In turn, miR-29 itself is regulated by SP1 activity and transforming growth factor-β signaling. RDEB mice express high levels of transforming growth factor-β and significantly lower miR-29 compared with wild-type cohorts. The sustained decrease in miR-29 in RDEB skin leads to an increase of miR-29 target genes expressed in the skin, including profibrotic extracellular matrix collagens. Collectively, we identify miR-29 as an important factor in both regulating COL7A1 and inhibiting transforming growth factor-β–mediated fibrosis.

      Abbreviations:

      C7 (type VII collagen), mRNA (messenger RNA), miR (micro RNA), qRT-PCR (quantitative real-time reverse transcriptase–PCR), RDEB (recessive dystrophic epidermolysis bullosa), TGF (transforming growth factor), UTR (untranslated region)

      Introduction

      Recessive dystrophic epidermolysis bullosa (RDEB) is a severe genetic skin disorder characterized by chronic skin blistering and abnormal wound healing (
      • Nystrom A.
      • Velati D.
      • Mittapalli V.R.
      • Fritsch A.
      • Kern J.S.
      • Bruckner-Tuderman L.
      Collagen VII plays a dual role in wound healing.
      ). Many long-term complications of RDEB are a result of systemic inflammation and contractile fibrosis due, in part, to an increase in transforming growth factor (TGF)-β signaling (
      • Fritsch A.
      • Loeckermann S.
      • Kern J.S.
      • Braun A.
      • Bosl M.R.
      • Bley T.A.
      • et al.
      A hypomorphic mouse model of dystrophic epidermolysis bullosa reveals mechanisms of disease and response to fibroblast therapy.
      ). Fibrosis leads to scarring, fusion of the digits and toes, and joint contractures. A number of cell-, protein-, and gene-based therapies are underway to correct the primary defect of RDEB, but even with their successes, the RDEB disease cascade, dominated by inflammation and fibrosis, will need additional therapies (
      • Remington J.
      • Wang X.
      • Hou Y.
      • Zhou H.
      • Burnett J.
      • Muirhead T.
      • et al.
      Injection of recombinant human type VII collagen corrects the disease phenotype in a murine model of dystrophic epidermolysis bullosa.
      ,
      • Wagner J.E.
      • Ishida-Yamamoto A.
      • Mcgrath J.A.
      • Hordinsky M.
      • Keene d.R.
      • Woodley D.T.
      • et al.
      Bone marrow transplantation for recessive dystrophic epidermolysis bullosa.
      ). Further understanding of the biological mechanisms driving fibrosis in RDEB is required for any meaningful therapy.
      The underlying defect of RDEB is loss-of-function mutations in the COL7A1 gene, which encodes for the structural protein type VII collagen (C7) (
      • Kern J.S.
      • Grüninger G.
      • Imsak R.
      • Müller M.L.
      • Schumann H.
      • Kiritsi D.
      • et al.
      Forty-two novel COL7A1 mutations and the role of a frequent single nucleotide polymorphism in the MMP1 promoter in modulation of disease severity in a large European dystrophic epidermolysis bullosa cohort.
      ). C7 is the major component of anchoring fibrils, the function of which is to establish and maintain structural adhesion between the dermis and the epidermis. C7 is produced in the skin by both keratinocytes and fibroblasts and then deposited at the dermal-epidermal junction, where it plays a major role in skin integrity and wound repair. Regulation of the COL7A1 gene in keratinocytes and fibroblasts occurs at the transcriptional level through SP1, a transcriptional factor that is responsible for basal expression of many genes lacking a canonical TATA box (
      • Vindevoghel L.
      • Chung K.Y.
      • Davis A.
      • Kouba D.
      • Kivirikko S.
      • Alder H.
      • et al.
      A GT-rich sequence binding the transcription factor Sp1 is crucial for high expression of the human type VII collagen gene (COL7A1) in fibroblasts and keratinocytes.
      ). Further regulation of COL7A1 occurs during various forms of skin injury and wound healing. On the transcriptional level, COL7A1 is up-regulated by TGF-β signaling via SMAD3/4 activity (
      • Vindevoghel L.
      • Lechleider R.J.
      • Kon A.
      • de Caestecker M.P.
      • Uitto J.
      • Roberts A.B.
      • et al.
      SMAD3/4-dependent transcriptional activation of the human type VII collagen gene (COL7A1) promoter by transforming growth factor beta.
      ). During inflammation, IL-1β or tumor necrosis factor-α signaling leads to an increase in COL7A1 expression in fibroblasts but a decrease in COL7A1 expression in keratinocytes (
      • Kon A.
      • Takeda H.
      • Ito N.
      • Takagaki K.
      Tissue-specific downregulation of type VII collagen gene (COL7A1) transcription in cultured epidermal keratinocytes by ultraviolet A radiation (UVA) and UVA-inducible cytokines, with special reference to cutaneous photoaging.
      ). However, posttranscriptional regulation of COL7A1 in the context of wound healing and fibrosis is poorly understood.
      Fibrosis in other settings, such as pulmonary and renal fibrosis, is influenced by TGF-β activity (
      • Qin W.
      • Chung A.C.
      • Huang X.R.
      • Meng X.M.
      • Hui D.S.
      • Yu C.M.
      • et al.
      TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29.
      ). Pathological fibrosis in these settings is also heavily dependent on micro RNA (miR) activity, most importantly, miR-29 (
      • Parker M.W.
      • Rossi D.
      • Peterson M.
      • Smith K.
      • Sikström K.
      • White E.S.
      • et al.
      Fibrotic extracellular matrix activates a profibrotic positive feedback loop.
      ). The miR-29 family has been shown to regulate extracellular matrix during fibrosis: reduction in miR-29 levels results in an increase in extracellular matrix proteins, which subsequently leads to fibrosis. In most cases, TGF-β signaling is responsible for the reduction in miR-29 levels during fibrosis, and either targeting the TGF-β pathway or artificially increasing miR-29 activity in the context of fibrosis has been shown to reduce disease severity (
      • Zhou L.
      • Wang L.
      • Lu L.
      • Jiang P.
      • Sun H.
      • Wang H.
      Inhibition of miR-29 by TGF-beta-Smad3 signaling through dual mechanisms promotes transdifferentiation of mouse myoblasts into myofibroblasts.
      ).
      Here, we show that miR-29 directly regulates COL7A1 (in part via targeting the 3′ untranslated region [UTR]) and decreases SP1 expression (which leads to indirect regulation of COL7A1 transcription). We propose a mechanism whereby healthy wound healing in the skin leads to an increase in COL7A1 expression through TGF-β mediated repression of miR-29; whereas in the context of RDEB, pathological changes in TGF-β expression and long-term reduction in miR-29 levels promote fibrosis.

      Results

      Identification of potential miR-COL7A1 interactions

      To identify miRs most relevant to COL7A1 regulation, we used miR-messenger RNA (mRNA) target prediction software. Bioinformatics software tools are a well-established approach for predicting miR-mRNA interactions in silico (
      • Lewis B.P.
      • Burge C.B.
      • Bartel D.P.
      Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets.
      ). These prediction tools rely on established interactions between miRs and their respective mRNA targets (
      • Friedman R.C.
      • Farh K.K.
      • Burge C.B.
      • Bartel D.P.
      Most mammalian mRNAs are conserved targets of microRNAs.
      ). This interaction involves a sequence of 6–8 base pairs in the mRNA target complementary to the 5′ end of the miR known as the seed region. Highly conserved seed regions in the 3′ UTR of an mRNA are hallmarks of genuine miR-mRNA interactions, representing evolutionary pressure to conserve miR regulation of a particular target mRNA.
      We used prediction software to investigate whether the 3′ UTR of COL7A1 showed any seed regions for known miRs, preferentially focusing on regions that were highly conserved among mammalian species. Targetscan software analysis (available at http://www.targetscan.org/) predicted two seed regions in the 3′ UTR of COL7A1 that are broadly conserved among mammalian species for miR-29 family members. These two seed regions (Figure 1a) are located at 77–84 base pairs and 290–296 base pairs of the COL7A1 3′ UTR. Both sites are complementary to the 5′ end of miR-29 and are predicted to base-pair with miR-29. Furthermore, miR-29 has been shown to be expressed in normal dermal fibroblasts (
      • Cheng J.
      • Wang Y.
      • Wang D.
      • Wu Y.
      Identification of collagen 1 as a post-transcriptional target of miR-29b in skin fibroblasts: therapeutic implication for scar reduction.
      ), cells found near the dermal-epidermal junction where fibroblasts secrete C7 and other extracellular matrix components. We focused on miR-29 over other potential candidates for further analysis because of the two predicted seed regions in the COL7A1 3′ UTR and prior studies showing miR-29 regulation of other collagens (
      • Qin W.
      • Chung A.C.
      • Huang X.R.
      • Meng X.M.
      • Hui D.S.
      • Yu C.M.
      • et al.
      TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29.
      ).
      Figure 1
      Figure 1miR-29 regulates COL7A1. (a) A schematic alignment between miR-29c and two regions of the COL7A1 3′ UTR: 63–84 base pairs and 275–297 base pairs, respectively. Alignment based on Targetscan miR-mRNA predictions. (b) Normal and (c) RDEB dermal fibroblasts as well as (d) normal and (e) RDEB keratinocytes were transiently transfected with miR-29 mimics. qRT-PCR analysis of COL7A1 expression relative to GAPDH expression 24 hours after transfection. n = 3. Values represent mean ± SE. P < 0.05 (f) Normal and RDEB fibroblasts were transfected with miR-29 mimics and assayed for type VII collagen protein expression 72 hours after transfection. Blot was stained for type VII collagen and beta-actin as a loading control. (g) HEK-293 cells were co-transfected with a miR-29 mimic and a plasmid containing a firefly luciferase construct directly downstream of the COL7A1 3′ UTR and an independently regulated Renilla luciferase construct. Luciferase levels were measured 24 hours after transfection. Firefly luciferase levels were normalized to Renilla luciferase levels. n = 3. Values represent mean ± SE. P < 0.05. (h) 293T cells were co-transfected with both a plasmid containing a firefly luciferase construct containing the COL7A1 3′ UTR region and an independently regulated Renilla luciferase construct in combination with a miR-29 mimic. Luciferase levels were measured 24 hours after transfection. COL7A1 3′ UTR plasmids contained either wild-type sequences or mutations in either or both of the miR-29 seed regions. Firefly luciferase levels were normalized to Renilla luciferase levels. Values represent mean ± SE. P < 0.05 compared to the plasmid containing mutations in both sites 1 and 2. (i) HEK-293 cells were transiently transfected with miR-29 COL7A1 3′ UTR target protectors for either of the predicted miR-29 seed regions on the COL7A1 3’ UTR (Invitrogen, Waltham, MA); 24 hours after transfection, qRT-PCR analysis was performed to determine COL7A1 expression. qRT-PCR analysis of COL7A1 expression relative to GAPDH expression 24 hours after transfection. n = 3. Values represent mean ± SE. P < 0.05. hsa, human; mml, rhesus; qRT-PCR, quantitative real-time reverse transcriptase–PCR; mmu, mouse; RDEB, recessive dystrophic epidermolysis bullosa; rho, rat; SE, standard error; UTR, untranslated region; WT, wild type.

      miR-29 regulation of C7

      The miR-29 family consists of three miRs (miR-29a/b/c) synthesized at two different genomic loci on chromosomes 1 and 7 (
      • Jiang H.
      • Zhang G.
      • Wu J.H.
      • Jiang C.P.
      Diverse roles of miR-29 in cancer (review).
      ). The mature forms of each miR-29 (3′) species share the same 5′ sequence necessary for sequence-specific miR-mRNA interaction and consequently share overlapping function in regulating specific mRNA targets. It has been previously reported that miR-29 is responsible for regulating expression of multiple collagens, including COL1A1, COL1A2, COL3A1, COL4A1, COL5A1, COL5A2, COL15A1 (
      • Cheng J.
      • Wang Y.
      • Wang D.
      • Wu Y.
      Identification of collagen 1 as a post-transcriptional target of miR-29b in skin fibroblasts: therapeutic implication for scar reduction.
      ,
      • Liu Y.
      • Taylor N.E.
      • Lu L.
      • Usa K.
      • Cowley Jr., A.W.
      • Ferreri N.R.
      • et al.
      Renal medullary microRNAs in Dahl salt-sensitive rats: miR-29b regulates several collagens and related genes.
      ,
      • Luna C.
      • Li G.
      • Qiu J.
      • Epstein D.L.
      • Gonzalez P.
      Role of miR-29b on the regulation of the extracellular matrix in human trabecular meshwork cells under chronic oxidative stress.
      ,
      • Yang T.
      • Liang Y.
      • Lin Q.
      • Liu J.
      • Luo F.
      • Li X.
      • et al.
      miR-29 mediates TGFbeta1-induced extracellular matrix synthesis through activation of PI3K-AKT pathway in human lung fibroblasts.
      ). Given this information and the results from target prediction software, we sought to determine whether miR-29 was capable of regulating COL7A1. To investigate this, we transfected synthetic mimics of miR-29 into dermal fibroblasts and assayed them for COL7A1 expression using quantitative real-time reverse transcriptase–PCR (qRT-PCR) 24 hours after transfection. Transfection of dermal fibroblasts and keratinocytes with miR-29 mimics led to a decrease in COL7A1 expression levels compared with mimic controls (Figure 1b–e). We observed similar results when measuring C7 protein after miR-29 mimic transfection as well (Figure 1f). This shows that miR-29 activity inhibits COL7A1 expression.
      To further define the relationship between COL7A1 and miR-29, we aimed to determine whether the regulation of miR-29 on COL7A1 was direct or indirect, because previous studies have shown that miR-29 is capable of regulating other collagens either directly or indirectly. For example, in pulmonary fibrosis miR-29 has been shown to directly target COL1A1 via interaction with its 3′ UTR (
      • Cushing L.
      • Kuang P.P.
      • Qian J.
      • Shao F.
      • Wu J.
      • Little F.
      • et al.
      miR-29 is a major regulator of genes associated with pulmonary fibrosis.
      ). Conversely, in renal fibrosis miR-29 was shown to indirectly increase type I collagen production through the targeting of SP1, a transcription factor required for basal expression of COL1A1 (
      • Chen H.Y.
      • Zhong X.
      • Huang X.R.
      • Meng X.M.
      • You Y.
      • Chung A.C.
      • et al.
      MicroRNA-29b inhibits diabetic nephropathy in db/db mice.
      ,
      • Cheng J.
      • Wang Y.
      • Wang D.
      • Wu Y.
      Identification of collagen 1 as a post-transcriptional target of miR-29b in skin fibroblasts: therapeutic implication for scar reduction.
      ,
      • Jiang L.
      • Zhou Y.
      • Xiong M.
      • Fang L.
      • Wen P.
      • Cao H.
      • et al.
      Sp1 mediates microRNA-29c-regulated type I collagen production in renal tubular epithelial cells.
      ). To determine whether miR-29 was capable of targeting the COL7A1 transcript, we generated luciferase reporter plasmids containing the 3′ UTR of COL7A1. Co-transfection of 293T cells with the COL7A1 3′ UTR reporter plasmid and synthetic miR-29 mimics led to a decrease in firefly luciferase activity compared with mimic controls (Figure 1g). This shows that miR-29 is capable of regulating COL7A1, at least in part through direct interactions with its 3′ UTR.
      Because miR-29 is predicted to interact with the COL7A1 3′ UTR at two distinct seed regions (Figure 1a), we wished to determine how these seed regions mediate miR-29 regulation of C7. To that end, we generated reporter constructs in which either or both of the seed regions were mutated to disrupt the predicted base-pairing between miR-29 and the 3′ UTR complementary sequence. Mutations in either of the seed sequences reduced the effect of miR-29 on the COL7A1 3′ UTR reporter construct, whereas mutations in both seed sequences abolished miR-29’s effect on the COL7A1 3′ UTR reporter altogether (Figure 1h). We found no significant differences in luciferase levels between experiments in which miR-29 seed sequence 1 was mutated versus the reporter construct in which seed sequence 2 was mutated. This shows that both miR-29 seed sequences in the 3′ UTR of COL7A1 are required in regulating COL7A1 expression.
      To further examine the functional specificity of each of the miR-29 seed sequences in COL7A1, we utilized 3′ UTR target protectors. These synthetic oligonucleotides consist of a single-stranded RNA molecule that is complementary to the 3′ UTR of interest. Specifically, we developed two distinct target protectors that effectively masked each seed region required for direct miR-29 regulation of the COL7A1 transcript. Upon transfection of these target protectors into dermal fibroblasts, we saw a dose-dependent increase in COL7A1 expression compared with nontransfected controls (Figure 1i). Collectively, these data show that miR-29 regulates C7 through directly targeting its 3′ UTR and confirm that both seed regions contribute to miR-29 regulation of C7.

      miR-29 regulates COL7A1 indirectly via targeting its transcription factor SP1

      Previous studies have shown that miR-29 is capable of negatively regulating SP1 (
      • Jiang L.
      • Zhou Y.
      • Xiong M.
      • Fang L.
      • Wen P.
      • Cao H.
      • et al.
      Sp1 mediates microRNA-29c-regulated type I collagen production in renal tubular epithelial cells.
      ). miR-29 has been shown to regulate COL1A1 directly in fibroblasts associated with fibrosis and indirectly through SP1 in renal tubular epithelial cells (
      • Cheng J.
      • Wang Y.
      • Wang D.
      • Wu Y.
      Identification of collagen 1 as a post-transcriptional target of miR-29b in skin fibroblasts: therapeutic implication for scar reduction.
      ,
      • Jiang L.
      • Zhou Y.
      • Xiong M.
      • Fang L.
      • Wen P.
      • Cao H.
      • et al.
      Sp1 mediates microRNA-29c-regulated type I collagen production in renal tubular epithelial cells.
      ). SP1 is a ubiquitously expressed transcription factor required for basal transcription of COL7A1; therefore factors that influence SP1 transcriptional activity are capable of indirectly influencing COL7A1 expression (
      • Vindevoghel L.
      • Chung K.Y.
      • Davis A.
      • Kouba D.
      • Kivirikko S.
      • Alder H.
      • et al.
      A GT-rich sequence binding the transcription factor Sp1 is crucial for high expression of the human type VII collagen gene (COL7A1) in fibroblasts and keratinocytes.
      ). To investigate whether miR-29 was capable of regulating SP1, we transfected normal and RDEB dermal fibroblasts with synthetic mimics of miR-29 and assayed SP1 gene expression 24 hours after transfection. Transfection of dermal fibroblasts with miR-29 mimics led to a decrease in SP1 expression levels compared with controls (Figure 2a and b). To further refine the mechanism of SP1 regulation by miR-29, we used a reporter that contains five tandem repeats of the SP1 transcriptional response element and thus directly reflects the transcriptional activity of SP1. When we co-transfected this reporter construct with miR-29 mimics, we saw a decrease in relative luciferase activity (Figure 2c). Conversely, when we co-transfected this reporter with inhibitors of miR-29, we saw an increase in luciferase activity (Figure 2c). This confirms that miR-29 is capable of regulating genes indirectly through targeting the transcription factor SP1.
      Figure 2
      Figure 2SP1 and miR-29 co-regulate each other and COL7A1. (a) Normal and (b) RDEB dermal fibroblasts were transfected with miR-29 mimics. qRT-PCR analysis of SP1 expression relative to GAPDH expression 24 hours after transfection. n = 3. Values represent mean ± SE. P < 0.05. (c) 293T cells were transiently co-transfected with a luciferase reporter assay containing tandem repeats of the SP1 transcriptional response element in combination with either miR-29 mimics or inhibitors (Invitrogen, Waltham, MA). Luciferase levels were measured 24 hours after transfection. Firefly luciferase levels were normalized to Renilla luciferase levels. n = 3. Values represent mean ± SE. P < 0.05. (d) 293T cells were transfected with an SP1 overexpression vector for 24 hours. qRT-PCR analysis of miR-29 levels was performed relative to U6 levels. n = 3. Values represent mean ± SE. P < 0.05. (e) Normal and (f) RDEB fibroblasts were transiently transfected with SP1 small interfering RNA for 48 hours. qRT-PCR analysis of miR-29 levels was performed relative to U6 levels. n = 3. Values represent mean ± SE. P < 0.05. (g) Normal and (h) RDEB fibroblasts were treated with mithramycin A (an inhibitor of SP1 binding) for 48 hours. qRT-PCR analysis of miR-29 levels was performed relative to U6 levels. n = 3. Values represent mean ± SE. P < 0.05. Inhibition of SP1 binding decreases COL7A1 and SP1 expression. (i) Normal and (j) RDEB fibroblasts were treated with mithramycin A (an inhibitor of SP1 binding) for 48 hours. qRT-PCR analysis of COL7A1 and SP1 levels was performed relative to GAPDH. n = 3. Values represent mean ± SE. P < 0.05. miR, micro RNA; RDEB, recessive dystrophic epidermolysis bullosa; qRT-PCR, quantitative real-time reverse transcriptase–PCR; SE, standard error; siRNA, small interfering RNA.

      SP1 and miR-29 exhibit a co-inhibitory loop

      Previous studies have shown that SP1 is capable of negatively regulating miR-29 expression (
      • Li N.
      • Cui J.
      • Duan X.
      • Chen H.
      • Fan F.
      Suppression of type I collagen expression by miR-29b via PI3K, Akt, and Sp1 pathway in human Tenon's fibroblasts.
      ,
      • Liu S.
      • Wu L.C.
      • Pang J.
      • Santhanam R.
      • Schwind S.
      • Wu Y.Z.
      • et al.
      Sp1/NFkappaB/HDAC/miR-29b regulatory network in KIT-driven myeloid leukemia.
      ). To determine if SP1 regulates miR-29, we transfected 293T cells with an SP1-expression cassette and measured miR-29 levels 24 hours after transfection. Transfection with the SP1 cassette led to a decrease in miR-29 levels (Figure 2d). Conversely, transfection with a short interfering RNA targeting SP1 led to an increase in miR-29 levels (Figure 2e and f), showing that SP1 regulates miR-29. To further delineate the roles of SP1 and miR-29 in regulation of COL7A1, we used mithramycin A, which binds to guanine-cytosine–rich sequences and subsequently inhibits the binding and activity of SP1 (
      • Sleiman S.F.
      • Langley B.C.
      • Basso M.
      • Berlin J.
      • Xia L.
      • Payappilly J.B.
      • et al.
      Mithramycin is a gene-selective Sp1 inhibitor that identifies a biological intersection between cancer and neurodegeneration.
      ). Normal and RDEB fibroblasts treated with mithramycin A showed increased miR-29 expression (Figure 2g and h). Conversely, when normal and RDEB fibroblasts were treated with mithramycin A, we saw a decrease in both SP1 and COL7A1 expression (Figure 2i and j). These data show a negative regulatory loop by which miR-29 targets SP1 and leads to a decrease in SP1 expression and activity, whereas SP1 transcriptional activity leads to a decrease in miR-29 levels. Furthermore, because both SP1 and miR-29 are capable of regulating COL7A1 expression, changes in miR-29 or SP1 levels could amplify changes in COL7A1 expression because of changes in the miR-29/SP1 regulatory loop.

      miR-29 levels are decreased in RDEB skin

      Hallmarks of the phenotype of RDEB in the skin include chronic skin blistering and scarring with nonproductive wound healing. This is pronounced in the extremities, where the progression of chronic blistering in the digits leads to pseudosyndactyly. Characterization of these regions showed TGF-β accumulation and aberrant contractile fibrosis in the dermis of Col7aflNeo/flNeo mice (
      • Fritsch A.
      • Loeckermann S.
      • Kern J.S.
      • Braun A.
      • Bosl M.R.
      • Bley T.A.
      • et al.
      A hypomorphic mouse model of dystrophic epidermolysis bullosa reveals mechanisms of disease and response to fibroblast therapy.
      ). Treatment of the RDEB mouse model using losartan led to a decrease in TGF-β signaling and a reduction in fibrosis and fusion of the digits (
      • Nystrom A.
      • Thriene K.
      • Mittapalli V.
      • Kern J.S.
      • Kiritsi D.
      • Dengjel J.
      • et al.
      Losartan ameliorates dystrophic epidermolysis bullosa and uncovers new disease mechanisms.
      ). Based on the work of others identifying miR-29 as a key player in TGF-β–mediated fibrosis (
      • Cushing L.
      • Kuang P.P.
      • Qian J.
      • Shao F.
      • Wu J.
      • Little F.
      • et al.
      miR-29 is a major regulator of genes associated with pulmonary fibrosis.
      ,
      • Qin W.
      • Chung A.C.
      • Huang X.R.
      • Meng X.M.
      • Hui D.S.
      • Yu C.M.
      • et al.
      TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29.
      ,
      • van Rooij E.
      • Sutherland L.B.
      • Thatcher J.E.
      • DiMaio J.M.
      • Naseem R.H.
      • Marshall W.S.
      • et al.
      Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis.
      ), we set out to determine the levels of miR-29 in RDEB skin compared with in healthy controls. We found that the miR-29 levels were significantly lower in skin isolated from COL7A1flNeo/flNeo mice versus wild-type controls (Figure 3).
      Figure 3
      Figure 3COL7A1flNeo/flNeo homozygous mice exhibit reduced miR-29 expression. Small RNA was isolated from skin samples from both COL7A1flNeo/flNeo mice and wild-type controls. qRT-PCR analysis of miR-29 levels was performed relative to U6 levels. n = 3. Values represent mean ± SE. P < 0.05. miR, micro RNA; qRT-PCR, quantitative real-time reverse transcriptase–PCR; SE, standard error; WT, wild type.

      miR-29 is down-regulated in normal dermal and RDEB fibroblasts and keratinocytes via TGF-β signaling

      C7 expression is increased in response to injury to the skin (
      • Nakano H.
      • Gasparro F.P.
      • Uitto J.
      UVA-340 as energy source, mimicking natural sunlight, activates the transcription factor AP-1 in cultured fibroblasts: evidence for involvement of protein kinase-C.
      ,
      • Vindevoghel L.
      • Lechleider R.J.
      • Kon A.
      • de Caestecker M.P.
      • Uitto J.
      • Roberts A.B.
      • et al.
      SMAD3/4-dependent transcriptional activation of the human type VII collagen gene (COL7A1) promoter by transforming growth factor beta.
      ). In particular, C7 expression has been shown to increase after activation of the TGF-β pathway (
      • Vindevoghel L.
      • Lechleider R.J.
      • Kon A.
      • de Caestecker M.P.
      • Uitto J.
      • Roberts A.B.
      • et al.
      SMAD3/4-dependent transcriptional activation of the human type VII collagen gene (COL7A1) promoter by transforming growth factor beta.
      ). TGF-β signaling leads to phosphorylation of downstream effector SMAD proteins, of which activated SMAD3 and -4 bind to COL7A1 promoter and promote COL7A1 transcription. Furthermore, TGF-β activation influences RDEB disease severity through increased type 1 collagen and decreased decorin expression (
      • Odorisio T.
      • Di Salvio M.
      • Orecchia A.
      • Di Zenzo G.
      • Piccinni E.
      • Cianfarani F.
      • et al.
      Monozygotic twins discordant for recessive dystrophic epidermolysis bullosa phenotype highlight the role of TGF-beta signalling in modifying disease severity.
      ). Previous studies have also shown that TGF-β signaling results in a decrease in miR-29 expression through inhibition of transcription via binding of SMAD3 to the miR-29 promoter region (
      • Qin W.
      • Chung A.C.
      • Huang X.R.
      • Meng X.M.
      • Hui D.S.
      • Yu C.M.
      • et al.
      TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29.
      ,
      • Zhou L.
      • Wang L.
      • Lu L.
      • Jiang P.
      • Sun H.
      • Wang H.
      Inhibition of miR-29 by TGF-beta-Smad3 signaling through dual mechanisms promotes transdifferentiation of mouse myoblasts into myofibroblasts.
      ). SMAD activity on the miR-29 promoter region results in a decrease of the primary (pri) miR as well as downstream mature miR levels. Therefore, we sought to investigate if miR-29 levels changed in response to TGF-β in normal and RDEB fibroblasts and keratinocytes. After exposure of normal and RDEB dermal fibroblasts and keratinocytes to TGF-β1, miR-29 levels decreased compared with untreated controls (Figure 4a–d). To determine if primary miR-29 levels were decreased in RDEB and normal fibroblasts after TGF-β exposure, we exposed RDEB fibroblasts for 24 hours and subsequently assayed for primary miR-29 levels. After exposure to TGF-β1, we saw a decrease in pri-miR-29A, pri-miR-29B1, pri-miR29-B2, and pri-miR-29C levels (Figure 4e and f). To further investigate whether endogenous levels of TGF-β signaling were sufficient for miR-29 regulation, we used small interfering RNA knockdown of both TGFB1 and its downstream transcription factor, SMAD3. Upon transfection of both TGFB1 (Figure 4g and h) and SMAD3 (Figure 4i and j) knockdown we see an increase in miR-29 levels 48 hours after transfection. Furthermore, inhibition of TGF-β receptor signaling by use of a TGF-β receptor inhibitor (SB431542) results in an increase in miR-29 levels 24 hours after treatment (Figure 4k and l). In vivo, however, TGF-β injection did not result in a significant decrease in miR-29 levels. This is likely due to multiple factors in RDEB skin contributing to miR-29 regulation and prolonged TGF-β signaling (see Supplementary Figure S1 online). These data show that TGF-β signaling reduces miR-29 levels, which indirectly increases COL7A1 levels through de-repression of miR-29 regulation. Furthermore, they show that TGF-β signaling alters COL7A1 expression at both the transcriptional and posttranscriptional levels. This is further enhanced through the activity of SP1, both through COL7A1 transcription and miR-29 inhibition (Figure 5).
      Figure 4
      Figure 4TGF-β down-regulates miR-29. Both (a) normal and (b) RDEB fibroblasts as well as (c) normal and (d) RDEB keratinocytes were treated with TGF-β1 for 24 hours. qRT-PCR analysis of miR-29 levels was performed relative to U6 levels. n = 3. Values represent mean ± SE. P < 0.05. (e) Normal and (f) RDEB fibroblasts were treated with TGF-β1 for 24 hours. qRT-PCR analysis of primary miR-29 levels relative to GAPDH levels. n = 3. Values represent mean ± SE. P < 0.05. (g) Normal and (h) RDEB fibroblasts were transiently transfected with TGF-β1 siRNA for 48 h. Quantitative RT-PCR analysis of miR-29 levels relative to U6 levels. N = 3. Values represent mean ± SE. P < 0.05. (i) Normal and (j) RDEB fibroblasts were transiently transfected with SMAD3 siRNA for 48 hours. qRT-PCR analysis of miR-29 levels was performed relative to U6 levels. n = 3. Values represent mean ± SE. P < 0.05. (k) Normal and (l) RDEB fibroblasts were treated with a TGF-β1 receptor inhibitor, SB431542. qRT-PCR analysis of miR-29 levels was performed relative to U6 levels. n = 3. Values represent mean ± SE. P < 0.05. miR, micro RNA; RDEB, recessive dystrophic epidermolysis bullosa; qRT-PCR, quantitative real-time reverse transcriptase–PCR; SE, standard error; siRNA, small interfering RNA; TGF, transforming growth factor.
      Figure 5
      Figure 5miR-29 regulation of COL7A1. A schematic diagram illustrating miR-29 regulation of COL7A1. miR-29 regulates COL7A1 directly through two seed sequences in the COL7A1 3′ untranslated region as well as indirectly through regulating its basal transcription factor, SP1. SP1 and miR-29 regulate each other in a negative fashion, establishing a co-inhibitory loop. During wound healing, TGF-β signaling leads to phosphorylation and activation of downstream SMAD transcription factors, which results in a subsequent decrease in miR-29 levels and an increase in SP1 and COL7A1 expression. TGF, transforming growth factor; miR, micro RNA.

      Discussion

      Previous reports have focused on the role of COL7A1 expression at the transcriptional level. Here, we show a mechanism by which COL7A1 is regulated at the transcriptional and posttranscriptional levels by miR-29. Further, we confirm that TGF-β signaling results in a decrease in miR-29 levels, antagonizing regulatory control of miR-29 on COL7A1 and leading to de-repression of COL7A1. This regulation is coupled with an indirect regulation of miR-29 on COL7A1 through regulation of its basal transcription factor SP1. SP1 and miR-29 act in a negative co-regulatory loop that is perturbed by TGF-β signaling. Reduction of miR-29 in response to TGF-β signaling likely functions in skin homeostasis to increase extracellular matrix production during wound healing and re-epithelialization.
      C7 plays a crucial role in both maintaining structural integrity of the skin and assisting in wound closure (
      • Nystrom A.
      • Velati D.
      • Mittapalli V.R.
      • Fritsch A.
      • Kern J.S.
      • Bruckner-Tuderman L.
      Collagen VII plays a dual role in wound healing.
      ). Therefore, increasing C7 expression at both the transcriptional and posttranscriptional levels would be beneficial for tissue repair. However, prolonged reduction in miR-29 levels may also lead to complications such as the fibrosis that leads to joint contractures and pseudosyndactyly (
      • Qin W.
      • Chung A.C.
      • Huang X.R.
      • Meng X.M.
      • Hui D.S.
      • Yu C.M.
      • et al.
      TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29.
      ,
      • Zhou L.
      • Wang L.
      • Lu L.
      • Jiang P.
      • Sun H.
      • Wang H.
      Inhibition of miR-29 by TGF-beta-Smad3 signaling through dual mechanisms promotes transdifferentiation of mouse myoblasts into myofibroblasts.
      ). A mouse model for RDEB has shown an increase in TGF-β1 in RDEB skin, resulting in an accumulation of myofibroblasts in the extremities, which is responsible for driving contractile fibrosis in the digits (
      • Fritsch A.
      • Loeckermann S.
      • Kern J.S.
      • Braun A.
      • Bosl M.R.
      • Bley T.A.
      • et al.
      A hypomorphic mouse model of dystrophic epidermolysis bullosa reveals mechanisms of disease and response to fibroblast therapy.
      ). This is likely further exacerbated by a reduction in miR-29, which leads to an increase in multiple collagens, mainly COL1A1 and COL3A1. Furthermore, prolonged reduction in miR-29 levels may promote an increase in other miR-29 targets associated with the development of squamous cell carcinoma, such as MMP2 and SP1 (
      • Jia L.F.
      • Huang Y.P.
      • Zheng Y.F.
      • Lyu M.Y.
      • Wei S.B.
      • Meng Z.
      • et al.
      miR-29b suppresses proliferation, migration, and invasion of tongue squamous cell carcinoma through PTEN-AKT signaling pathway by targeting Sp1.
      ,
      • Lu L.
      • Xue X.
      • Lan J.
      • Gao Y.
      • Xiong Z.
      • Zhang H.
      • et al.
      MicroRNA-29a upregulates MMP2 in oral squamous cell carcinoma to promote cancer invasion and anti-apoptosis.
      ).
      In the context of wound healing, miR-29 is among a host of other miRs in the skin that regulate the wound healing process. During wound healing, miR-21 has been shown to regulate migration and re-epithelialization of keratinocytes within the wound bed (
      • Yang X.
      • Wang J.
      • Guo S.L.
      • Fan K.J.
      • Li J.
      • Wang Y.L.
      • et al.
      miR-21 promotes keratinocyte migration and re-epithelialization during wound healing.
      ). Also, miR-31 has also been shown to regulate keratinocyte proliferation and migration, although through regulating a different set of genes than miR-21 (
      • Li D.
      • Li X.
      • Wang A.
      • Meisgen F.
      • Pivarcsi A.
      • Sonkoly E.
      • et al.
      MicroRNA-31 promotes skin wound healing by enhancing keratinocyte proliferation and migration.
      ). In this respect, miR-29 is among a network of other miRs that likely function in concert to regulate various aspects of wound healing, and how these miRs function together remains to be seen. Also, there are likely other miRs that are capable of regulating COL7A1, as well as other miRs that are dysregulated in the context of RDEB and may play a role in RDEB pathology as well.
      Although understanding COL7A1 regulation of miR-29 in the context of RDEB is important to understanding the disease pathology and nature of RDEB, understanding how other targets of miR-29 are expressed in the context of RDEB may prove to be useful as well (
      • Kuttner V.
      • Mack C.
      • Rigbolt K.T.
      • Kern J.S.
      • Schilling O.
      • Busch H.
      • et al.
      Global remodelling of cellular microenvironment due to loss of collagen VII.
      ). In the context of fibrosis, it is likely that dermal collagens such as COL1A1 and COL3A1 play a major role in fibrosis and are influenced by miR-29 regulation. Furthermore, miR-29 has been shown to influence DNA methylation through targeting TET1 and TDG (
      • Morita S.
      • Horii T.
      • Kimura M.
      • Ochiya T.
      • Tajima S.
      • Hatada I.
      miR-29 represses the activities of DNA methyltransferases and DNA demethylases.
      ) as well as DNMT3A, DNMT3B, and DNMT1 (
      • Garzon R.
      • Liu S.
      • Fabbri M.
      • Liu Z.
      • Heaphy C.E.
      • Callegari E.
      • et al.
      MicroRNA-29b induces global DNA hypomethylation and tumor suppressor gene reexpression in acute myeloid leukemia by targeting directly DNMT3A and 3B and indirectly DNMT1.
      ). Whether there are any significant changes in DNA methylation in RDEB remains to be seen, but if other miR-29 targets are regulated in the skin in similar fashion to COL7A1 and SP1, there is likely to be dysregulation of DNA methylation in RDEB because of miR-29 activity.
      Ideally, therapies for RDEB will result in an increase in functional, stable anchoring fibrils while reducing the amount of fibrosis and the incidence of squamous cell carcinoma. Future clinical applications focused on increasing functional C7 in RDEB skin through manipulation of miR-29 will require a targeted approach by separating miR-29 regulation of COL7A1 versus reducing overall miR-29 levels. Specifically, COL7A1 target protectors, which disrupt miR-29 regulation of COL7A1 without interfering with miR-29 regulation of other targets genes, may be the preferred approach. Furthermore, miR-29 may be a suitable biomarker for overall skin integrity, and measuring miR-29 levels of the skin of RDEB patients may be an indicator for fibrosis.

      Materials and Methods

      Cell culture

      RDEB, normal human dermal fibroblasts, and HEK-293T cells were maintained in DMEM supplemented with 10% fetal bovine serum, 100 U/ml nonessential amino acids, and 0.1 mg/ml each of penicillin and streptomycin (Invitrogen, Carlsbad, CA). Normal and RDEB keratinocytes were maintained in Epilife medium supplemented with 60 μmol/L calcium, 1% Epilife Defined Growth Supplement, and 1% gentamicin/amphotericin solution (Invitrogen, Carlsbad, CA).

      Inhibitors

      Mithramycin A (150 ng/ml, GR305-0001, VWR Scientific, Radnor, PA) or SB431542 (10 μmol/L, S-4317, Sigma-Aldrich, St. Louis, MO) were added directly to fibroblast media, and cells were incubated for 24–48 hours before RNA or small RNA isolation.

      Fibroblast transfection

      RDEB and normal human dermal fibroblasts, as well as RDEB and normal keratinocytes, were transiently transfected using the Neon Transfection System (Invitrogen). A total of 2 × 105 fibroblasts were transfected with either 90 pmol of miRvana miRNA mimic (miR-29a, miR-29b, miR-29c, or mimic control; Invitrogen) or miRvana miRNA inhibitor (miR-29a, miR-29b, miR-29c, or mimic control; Invitrogen) or small interfering RNA select (TGF-β1:s14056, SMAD3:s8402, and SP1:s13320) using the following settings: 1,500 V, 20-milisecond pulse width, 1 pulse. A total of 2 × 105 keratinocytes were transfected with 90 pmol of miRvana mimics using the following settings: 850 V, 30-milisecond pulse width, 2 pulses.

      293T transfection

      A total of 2.5 × 105 HEK-293T cells were transiently transfected using Lipofectamine 2000 reagent (Invitrogen). For the luciferase assays, 1 μg of each luciferase reporter was used in combination with either 90 pmol of miR-29 miRvana mimic or inhibitor. For the target protector assays, either a target protector control or various concentrations (50 pmol, 100 pmol, and 200 pmol) of miScript Target Protector (Qiagen, Valencia, CA), which were designed to mask either the first or second mir-29 seed sequence in the COL7A1 3′ UTR, were used for transfection. The sequence for COL7A1 target protector 1 was CCCACTGTCCCTCCCCTTGGTGCTAGAGGCTTGTGTGCAC and for COL7A1 target protector 2 was CCAAGCCTGTGATGACATGGTGCTGATTCTGGGGGCATT.

      RDEB mouse strain miR analysis

      All animal studies were approved by the University of Minnesota Institutional Animal Care and Use Committee. The RDEB hypomorphic mouse model, C57Bl/6-TgH(COL7A1flNeo)288LBT, was used for microRNA analysis (
      • Fritsch A.
      • Loeckermann S.
      • Kern J.S.
      • Braun A.
      • Bosl M.R.
      • Bley T.A.
      • et al.
      A hypomorphic mouse model of dystrophic epidermolysis bullosa reveals mechanisms of disease and response to fibroblast therapy.
      ). Full-thickness skin samples were isolated from RDEB hypomorphic pups and wild-type littermate controls. Samples were placed in RNAlater (Qiagen) before small RNA extraction. Skin samples were first processed using a Tissue-Tearor rotor/stator homogenizer (Biospec, Racine, WI) for 1 minute in mirPremier (Sigma-Aldrich, St. Louis, MO) miR lysis buffer before small RNA isolation.

      TGF-β injection

      C57Bl/6 wild-type mice were injected with 800 ng of carrier-free mouse TGF-β1 (Cell Signaling Technology, Danvers, MA) resuspended in 20 μl phosphate-buffered saline. Injections were done with a microneedle subcutaneously in the neck of neonatal mice. After 3 daily injections, skin samples were taken from the injection site and processed as described for small RNA isolation.

      qRT-PCR

      RNA was isolated using the RNeasy Plus Mini Kit (Qiagen). Subsequent first strand complementary DNA synthesis was performed using the SuperScript Vilo cDNA Synthesis Kit (Invitrogen). qRT-PCR was performed using Taqman Gene Expression Assays and Taqman Universal Master Mix II, no Uracil-N-Glycosylase (Invitrogen). qRT-PCR was performed on the StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA). The Taqman Gene Expression assays used were COL7A1 (Hs00164310_m1), SP1 (Hs00916521_m1), miR-29a-pri (Hs03302672_pri), miR-29b1-pri (Hs03302748_pri), miR-29b2-pri (Hs03302750_pri), and miR-29c-pri (Hs04225365_pri). Glyceraldehyde-3-phosphate dehydrogenase (Hs02758991_g1) was used as an endogenous control. Small RNA from mouse skin samples and cell culture was isolated using the mirPremier microRNA Isolation Kit (Sigma-Aldrich). Micro RNA was reverse transcribed using the Taqman MicroRNA Reverse Transcription Kit (Invitrogen). The following Taqman Micro RNA assays used were: miR-29a (002112), miR-29b (000413), and miR-29c (00587). U6 (001973) was used as a positive control.

      Immunoblot

      Normal and RDEB fibroblasts transfected with miR-29 mimics or controls as stated were incubated for 72 hours before cell lysis. Cells were lysed in radioimmunoprecipitation assay buffer containing a protease inhibitor cocktail (Sigma-Aldrich). Lysates were clarified and measured for protein concentration using a bicinchoninic acid protein assay before loading. Equal quantities of protein were loaded onto 3–8% Tris-acetate gel. After electrophoresis, protein was transferred onto a nitrocellulose membrane and incubated with anti-C7 antibody (a kind gift provided by David Woodley and Mei Chen) or anti–beta-actin (A2228, Sigma-Aldrich) antibody overnight. The following day, membranes were incubated with goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (sc-2005, Santa Cruz Biotechnology, Santa Cruz, CA). After incubation with secondary antibody, blots were developed using SuperSignal West Pico Chemiluminescent Substrate (ThermoFisher Scientific, Waltham, MA) and developed on X-ray film for imaging.

      Luciferase reporter plasmids

      Luciferase plasmid reporter constructs containing both the wild-type sequence of the COL7A1 3′ UTR or mutant derivatives containing changes in either or both of the miR-29 seed sequences were developed using the pMIRglo Dual Luciferase Vector (Promega, Madison, WI). MiR-29 seed sequences (Figure 1) were mutated as follows: UGGUGCU to ACCACGA for both site 1 and site 2.

      Statistics

      All data are presented as mean ± standard deviation of three independent biological replicates or more. Student t test was used to determine the significance between two groups or between an experimental variable and a control. P-values less than or equal to 0.05 were considered statistically significant.

      Conflict of Interest

      The authors state no conflict of interest.

      Acknowledgments

      Transgenic C57BI/6-TgH (COL7A1flNeo/flNeo) mice were generously provided for this research by Professor Leena Bruckner-Tuderman, MD and her laboratory. This work was supported in part by grants from the National Institutes of Health ( R01 AR063070 and R01AR059947 ), and U.S. Department of Defense ( W81XWH-12-1-0609 ).

      Supplementary Material

      References

        • Chen H.Y.
        • Zhong X.
        • Huang X.R.
        • Meng X.M.
        • You Y.
        • Chung A.C.
        • et al.
        MicroRNA-29b inhibits diabetic nephropathy in db/db mice.
        Mol Ther. 2014; 22: 842-853
        • Cheng J.
        • Wang Y.
        • Wang D.
        • Wu Y.
        Identification of collagen 1 as a post-transcriptional target of miR-29b in skin fibroblasts: therapeutic implication for scar reduction.
        Am J Med Sci. 2013; 346: 98-103
        • Cushing L.
        • Kuang P.P.
        • Qian J.
        • Shao F.
        • Wu J.
        • Little F.
        • et al.
        miR-29 is a major regulator of genes associated with pulmonary fibrosis.
        Am J Respir Cell Mol Biol. 2011; 45: 287-294
        • Friedman R.C.
        • Farh K.K.
        • Burge C.B.
        • Bartel D.P.
        Most mammalian mRNAs are conserved targets of microRNAs.
        Genome Res. 2009; 19: 92-105
        • Fritsch A.
        • Loeckermann S.
        • Kern J.S.
        • Braun A.
        • Bosl M.R.
        • Bley T.A.
        • et al.
        A hypomorphic mouse model of dystrophic epidermolysis bullosa reveals mechanisms of disease and response to fibroblast therapy.
        J Clin Invest. 2008; 118: 1669-1679
        • Garzon R.
        • Liu S.
        • Fabbri M.
        • Liu Z.
        • Heaphy C.E.
        • Callegari E.
        • et al.
        MicroRNA-29b induces global DNA hypomethylation and tumor suppressor gene reexpression in acute myeloid leukemia by targeting directly DNMT3A and 3B and indirectly DNMT1.
        Blood. 2009; 113: 6411-6418
        • Jia L.F.
        • Huang Y.P.
        • Zheng Y.F.
        • Lyu M.Y.
        • Wei S.B.
        • Meng Z.
        • et al.
        miR-29b suppresses proliferation, migration, and invasion of tongue squamous cell carcinoma through PTEN-AKT signaling pathway by targeting Sp1.
        Oral Oncol. 2014; 50: 1062-1071
        • Jiang H.
        • Zhang G.
        • Wu J.H.
        • Jiang C.P.
        Diverse roles of miR-29 in cancer (review).
        Oncol Rep. 2014; 31: 1509-1516
        • Jiang L.
        • Zhou Y.
        • Xiong M.
        • Fang L.
        • Wen P.
        • Cao H.
        • et al.
        Sp1 mediates microRNA-29c-regulated type I collagen production in renal tubular epithelial cells.
        Exp Cell Res. 2013; 319: 2254-2265
        • Kern J.S.
        • Grüninger G.
        • Imsak R.
        • Müller M.L.
        • Schumann H.
        • Kiritsi D.
        • et al.
        Forty-two novel COL7A1 mutations and the role of a frequent single nucleotide polymorphism in the MMP1 promoter in modulation of disease severity in a large European dystrophic epidermolysis bullosa cohort.
        Br J Dermatol. 2009; 161: 1089-1097
        • Kon A.
        • Takeda H.
        • Ito N.
        • Takagaki K.
        Tissue-specific downregulation of type VII collagen gene (COL7A1) transcription in cultured epidermal keratinocytes by ultraviolet A radiation (UVA) and UVA-inducible cytokines, with special reference to cutaneous photoaging.
        J Dermatol Sci Suppl. 2005; 1: S29-S35
        • Kuttner V.
        • Mack C.
        • Rigbolt K.T.
        • Kern J.S.
        • Schilling O.
        • Busch H.
        • et al.
        Global remodelling of cellular microenvironment due to loss of collagen VII.
        Mol Syst Biol. 2013; 9: 657
        • Lewis B.P.
        • Burge C.B.
        • Bartel D.P.
        Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets.
        Cell. 2005; 120: 15-20
        • Li D.
        • Li X.
        • Wang A.
        • Meisgen F.
        • Pivarcsi A.
        • Sonkoly E.
        • et al.
        MicroRNA-31 promotes skin wound healing by enhancing keratinocyte proliferation and migration.
        J Invest Dermatol. 2015; 135: 1676-1685
        • Li N.
        • Cui J.
        • Duan X.
        • Chen H.
        • Fan F.
        Suppression of type I collagen expression by miR-29b via PI3K, Akt, and Sp1 pathway in human Tenon's fibroblasts.
        Invest Ophthalmol Vis Sci. 2012; 53: 1670-1678
        • Liu Y.
        • Taylor N.E.
        • Lu L.
        • Usa K.
        • Cowley Jr., A.W.
        • Ferreri N.R.
        • et al.
        Renal medullary microRNAs in Dahl salt-sensitive rats: miR-29b regulates several collagens and related genes.
        Hypertension. 2010; 55: 974-982
        • Liu S.
        • Wu L.C.
        • Pang J.
        • Santhanam R.
        • Schwind S.
        • Wu Y.Z.
        • et al.
        Sp1/NFkappaB/HDAC/miR-29b regulatory network in KIT-driven myeloid leukemia.
        Cancer Cell. 2010; 17: 333-347
        • Lu L.
        • Xue X.
        • Lan J.
        • Gao Y.
        • Xiong Z.
        • Zhang H.
        • et al.
        MicroRNA-29a upregulates MMP2 in oral squamous cell carcinoma to promote cancer invasion and anti-apoptosis.
        Biomed Pharmacother. 2014; 68: 13-19
        • Luna C.
        • Li G.
        • Qiu J.
        • Epstein D.L.
        • Gonzalez P.
        Role of miR-29b on the regulation of the extracellular matrix in human trabecular meshwork cells under chronic oxidative stress.
        Mol Vis. 2009; 15: 2488-2497
        • Morita S.
        • Horii T.
        • Kimura M.
        • Ochiya T.
        • Tajima S.
        • Hatada I.
        miR-29 represses the activities of DNA methyltransferases and DNA demethylases.
        Int J Mol Sci. 2013; 14: 14647-14658
        • Nakano H.
        • Gasparro F.P.
        • Uitto J.
        UVA-340 as energy source, mimicking natural sunlight, activates the transcription factor AP-1 in cultured fibroblasts: evidence for involvement of protein kinase-C.
        Photochem Photobiol. 2001; 74: 274-282
        • Nystrom A.
        • Thriene K.
        • Mittapalli V.
        • Kern J.S.
        • Kiritsi D.
        • Dengjel J.
        • et al.
        Losartan ameliorates dystrophic epidermolysis bullosa and uncovers new disease mechanisms.
        EMBO Mol Med. 2015; 7: 1211-1228
        • Nystrom A.
        • Velati D.
        • Mittapalli V.R.
        • Fritsch A.
        • Kern J.S.
        • Bruckner-Tuderman L.
        Collagen VII plays a dual role in wound healing.
        J Clin Invest. 2013; 123: 3498-3509
        • Odorisio T.
        • Di Salvio M.
        • Orecchia A.
        • Di Zenzo G.
        • Piccinni E.
        • Cianfarani F.
        • et al.
        Monozygotic twins discordant for recessive dystrophic epidermolysis bullosa phenotype highlight the role of TGF-beta signalling in modifying disease severity.
        Hum Mol Genet. 2014; 23: 3907-3922
        • Parker M.W.
        • Rossi D.
        • Peterson M.
        • Smith K.
        • Sikström K.
        • White E.S.
        • et al.
        Fibrotic extracellular matrix activates a profibrotic positive feedback loop.
        J Clin Invest. 2014; 124: 1622-1635
        • Qin W.
        • Chung A.C.
        • Huang X.R.
        • Meng X.M.
        • Hui D.S.
        • Yu C.M.
        • et al.
        TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29.
        J Am Soc Nephrol. 2011; 22: 1462-1474
        • Remington J.
        • Wang X.
        • Hou Y.
        • Zhou H.
        • Burnett J.
        • Muirhead T.
        • et al.
        Injection of recombinant human type VII collagen corrects the disease phenotype in a murine model of dystrophic epidermolysis bullosa.
        Mol Ther. 2009; 17: 26-33
        • Sleiman S.F.
        • Langley B.C.
        • Basso M.
        • Berlin J.
        • Xia L.
        • Payappilly J.B.
        • et al.
        Mithramycin is a gene-selective Sp1 inhibitor that identifies a biological intersection between cancer and neurodegeneration.
        J Neurosci. 2011; 31: 6858-6870
        • van Rooij E.
        • Sutherland L.B.
        • Thatcher J.E.
        • DiMaio J.M.
        • Naseem R.H.
        • Marshall W.S.
        • et al.
        Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis.
        Proc Natl Acad Sci USA. 2008; 105: 13027-13032
        • Vindevoghel L.
        • Chung K.Y.
        • Davis A.
        • Kouba D.
        • Kivirikko S.
        • Alder H.
        • et al.
        A GT-rich sequence binding the transcription factor Sp1 is crucial for high expression of the human type VII collagen gene (COL7A1) in fibroblasts and keratinocytes.
        J Biol Chem. 1997; 272: 10196-10204
        • Vindevoghel L.
        • Lechleider R.J.
        • Kon A.
        • de Caestecker M.P.
        • Uitto J.
        • Roberts A.B.
        • et al.
        SMAD3/4-dependent transcriptional activation of the human type VII collagen gene (COL7A1) promoter by transforming growth factor beta.
        Proc Natl Acad Sci USA. 1998; 95: 14769-14774
        • Wagner J.E.
        • Ishida-Yamamoto A.
        • Mcgrath J.A.
        • Hordinsky M.
        • Keene d.R.
        • Woodley D.T.
        • et al.
        Bone marrow transplantation for recessive dystrophic epidermolysis bullosa.
        N Engl J Med. 2010; 363: 629-639
        • Yang T.
        • Liang Y.
        • Lin Q.
        • Liu J.
        • Luo F.
        • Li X.
        • et al.
        miR-29 mediates TGFbeta1-induced extracellular matrix synthesis through activation of PI3K-AKT pathway in human lung fibroblasts.
        J Cell Biochem. 2013; 114: 1336-1342
        • Yang X.
        • Wang J.
        • Guo S.L.
        • Fan K.J.
        • Li J.
        • Wang Y.L.
        • et al.
        miR-21 promotes keratinocyte migration and re-epithelialization during wound healing.
        Int J Biol Sci. 2011; 7: 685-690
        • Zhou L.
        • Wang L.
        • Lu L.
        • Jiang P.
        • Sun H.
        • Wang H.
        Inhibition of miR-29 by TGF-beta-Smad3 signaling through dual mechanisms promotes transdifferentiation of mouse myoblasts into myofibroblasts.
        PLoS One. 2012; 7: e33766

      CHORUS Manuscript

      View Open Manuscript