Advertisement

Desmoglein 1 Deficiency Causes Lethal Skin Blistering

  • Author Footnotes
    3 These authors contributed equally to this work.
    Daniela Kugelmann
    Footnotes
    3 These authors contributed equally to this work.
    Affiliations
    Ludwig-Maximilians-Universität Munich, Institute of Anatomy and Cell Biology, Department I, Munich, Germany
    Search for articles by this author
  • Author Footnotes
    3 These authors contributed equally to this work.
    Mariya Y. Radeva
    Footnotes
    3 These authors contributed equally to this work.
    Affiliations
    Ludwig-Maximilians-Universität Munich, Institute of Anatomy and Cell Biology, Department I, Munich, Germany
    Search for articles by this author
  • Volker Spindler
    Affiliations
    Ludwig-Maximilians-Universität Munich, Institute of Anatomy and Cell Biology, Department I, Munich, Germany

    University of Basel, Department of Biomedicine, Basel, Switzerland
    Search for articles by this author
  • Jens Waschke
    Correspondence
    Corresponding author
    Affiliations
    Ludwig-Maximilians-Universität Munich, Institute of Anatomy and Cell Biology, Department I, Munich, Germany
    Search for articles by this author
  • Author Footnotes
    3 These authors contributed equally to this work.
Open ArchivePublished:January 17, 2019DOI:https://doi.org/10.1016/j.jid.2019.01.002

      Abbreviation:

      Dsg (desmoglein)
      To the Editor
      Pemphigus is an autoimmune bullous disorder affecting both mucous membranes and the epidermis (
      • Kasperkiewicz M.
      • Ellebrecht C.T.
      • Takahashi H.
      • Yamagami J.
      • Zillikens D.
      • Payne A.S.
      • et al.
      ). It is widely accepted that pemphigus is caused by autoantibodies primarily targeting desmosomal cadherins desmoglein (Dsg)1 and 3, which are crucial for intercellular cohesion of keratinocytes. The relevance of autoantibodies against other antigens detectable in pemphigus patients is unclear yet (
      • Spindler V.
      • Eming R.
      • Schmidt E.
      • Amagai M.
      • Grando S.
      • Jonkman M.F.
      • et al.
      Mechanisms causing loss of keratinocyte cohesion in pemphigus.
      ). There are two main forms of pemphigus, which differ with respect to their clinical phenotype: in pemphigus vulgaris, skin blistering affects the deep epidermis when, in addition to antibodies against Dsg3, autoantibodies targeting Dsg1 are detectable (
      • Spindler V.
      • Waschke J.
      Pemphigus—a disease of desmosome dysfunction caused by multiple mechanisms.
      ). In pemphigus foliaceus, epidermal blistering is also associated with autoantibodies against Dsg1, but is confined to the superficial epidermis.
      By passive transfer, it has been shown in mouse models that autoantibodies against Dsg1 and Dsg3 induce pemphigus phenotypes similar to humans (
      • Mahoney M.G.
      • Wang Z.
      • Rothenberger K.
      • Koch P.J.
      • Amagai M.
      • Stanley J.R.
      Explanations for the clinical and microscopic localization of lesions in pemphigus foliaceus and vulgaris.
      ). More recently, it was proposed that different signaling mechanisms in pemphigus correlate with different autoantibody titers against Dsg1 and Dsg3 and define, at least in part, the different clinical phenotypes in pemphigus (
      • Walter E.
      • Vielmuth F.
      • Rotkopf L.
      • Sardy M.
      • Horvath O.N.
      • Goebeler M.
      • et al.
      Different signaling patterns contribute to loss of keratinocyte cohesion dependent on autoantibody profile in pemphigus.
      ). However, antibodies against Dsg1 in contrast to those against Dsg3 where not directly interfering with Dsg binding (
      • Heupel W.M.
      • Zillikens D.
      • Drenckhahn D.
      • Waschke J.
      Pemphigus vulgaris IgG directly inhibit desmoglein 3-mediated transinteraction.
      ,
      • Waschke J.
      • Bruggeman P.
      • Baumgartner W.
      • Zillikens D.
      • Drenckhahn D.
      Pemphigus foliaceus IgG causes dissociation of desmoglein 1-containing junctions without blocking desmoglein 1 transinteraction.
      ). Deletion of Dsg3 without loss of Dsg1 function causes a mild pemphigus vulgaris-like phenotype in the skin and conjunctiva (
      • Koch P.J.
      • Mahoney M.G.
      • Ishikawa H.
      • Pulkkinen L.
      • Uitto J.
      • Shultz L.
      • et al.
      Targeted disruption of the pemphigus vulgaris antigen (desmoglein 3) gene in mice causes loss of keratinocyte cell adhesion with a phenotype similar to pemphigus vulgaris.
      ,
      • Vielmuth F.
      • Rotzer V.
      • Hartlieb E.
      • Hirneiss C.
      • Waschke J.
      • Spindler V.
      Pemphigus autoantibodies induce blistering in human conjunctiva.
      ), whereas epidermis-specific deletion of desmocollin 3, a desmosomal cadherin also expressed in basal epidermis, but rarely targeted by pemphigus autoantibodies, induces a severe pemphigus vulgaris phenotype (
      • Chen J.
      • Den Z.
      • Koch P.J.
      Loss of desmocollin 3 in mice leads to epidermal blistering.
      ). On the other hand, inactivation of Dsg3 with a specific autoantibody derived from a pemphigus vulgaris mouse model has been shown to cause skin blistering in vivo (
      • Spindler V.
      • Rotzer V.
      • Dehner C.
      • Kempf B.
      • Gliem M.
      • Radeva M.
      • et al.
      Peptide-mediated desmoglein 3 crosslinking prevents pemphigus vulgaris autoantibody-induced skin blistering.
      ,
      • Tsunoda K.
      • Ota T.
      • Aoki M.
      • Yamada T.
      • Nagai T.
      • Nakagawa T.
      • et al.
      Induction of pemphigus phenotype by a mouse monoclonal antibody against the amino-terminal adhesive interface of desmoglein 3.
      ) and a monoclonal antibody against Dsg1 also induced superficial epidermal splitting in ex vivo human skin (
      • Yoshida K.
      • Ishii K.
      • Shimizu A.
      • Yokouchi M.
      • Amagai M.
      • Shiraishi K.
      • et al.
      Non-pathogenic pemphigus foliaceus (PF) IgG acts synergistically with a directly pathogenic PF IgG to increase blistering by p38MAPK-dependent desmoglein 1 clustering.
      ). Collectively, these finding indicate that Dsg1, Dsg3, and desmocollin 3 are important for keratinocyte cohesion. However, the fact that deletion of desmocollin 3 alone induces a pemphigus phenotype in mice (
      • Chen J.
      • Den Z.
      • Koch P.J.
      Loss of desmocollin 3 in mice leads to epidermal blistering.
      ) challenges the hypothesis that inactivation of Dsg1 is required and sufficient to induce skin blistering in both pemphigus vulgaris and pemphigus foliaceus. Thus, the role of Dsg1 for epidermal integrity is not entirely clear at present.
      To address this question, we established a mouse model with deletion of the Dsg1a-Dsg1c gene locus by CRISPR/Cas9 technology to delete the whole Dsg1 gene complex in Dsg1–/– mice (Figure 1a–c ). All nine mice with homologous Dsg1 inactivation (Dsg1–/–) died within 24 hours after birth (Figure 1d). Homozygous mice were substantially smaller and displayed loss of epidermis, whereas wild-type mice appeared macroscopically normal (Figure 1e). In contrast, most heterozygous (Dsg1+/–) mice were unaffected. Nevertheless, 3 out of 33 heterozygous mice also died within 24 hours after birth. When mice were removed ex utero before birth, Dsg1–/– displayed epidermal cleavage, but skin was largely intact, indicating that splitting of the epidermis occurred due to shear stress during birth (Figure 1f).
      Figure thumbnail gr1
      Figure 1Lack of Dsg1 leads to lethal epidermal blister formation. (a) Combination of single- guide RNAs flanking Dsg1b and c gene were selected (red and green arrows). The DNA damage was repaired by a nonhomologous end joining mechanism, introducing a deletion resulting in complete Dsg1 knockout. (b) Fertilized oocytes were microinjected with CRISRP/Cas9 expression vector carrying single-guide RNAs and transferred into foster mothers. (c) Genotyping of F1 generation revealed offspring with depletion of the entire Dsg1 locus. (d) Altogether, 63 mice were analyzed ( online). In contrast to Dsg1+/– mice with limited neonatal lethality, all newborn Dsg1–/– mice died within the first 24 hours. (e) Compared to Dsg1+/+ and Dsg1+/– mice, lack of Dsg1 induced severe skin blistering (arrowhead). (f) When embryos were collected ex utero, Dsg1–/– but not WT or Dsg1+/– littermates displayed epidermal cleavage (arrowhead). Dsc, desmocollin; Dsg, desmoglein; NHEJ, non-homologous end joining; NTC, non-template control.
      Hematoxylin and eosin staining revealed that in Dsg1–/–, but not in macroscopically normal Dsg1+/– and wild-type mice, the superficial epidermis was cleaved entirely within the granular layer (Figure 2a ). This phenotype is closely resembling the histology of pemphigus foliaceus patients’ lesions, in which antibodies against Dsg1 are found and believed to be the primary cause of skin blistering (
      • Waschke J.
      The desmosome and pemphigus.
      ). The toluidine blue penetration test showed that Dsg1–/– in contrast to wild-type and heterozygous animals completely lacked epidermal barrier function (Figure 2b). As shown by immunostaining and immunoblot analysis, Dsg1 was completely absent in Dsg1–/– epidermis (Figure 2c, Supplementary Figure 1b online), whereas the staining and expression patterns of other desmosomal cadherins and desmosomal plaque proteins, as well as of the adherens junction molecule E-cadherin, remained unaltered in any genotype analyzed (Figure 2c, Supplementary Figure S1a, S1b). In line with a previous study demonstrating the formation of tight junctions in the superficial epidermal layers of the stratum granulosum (
      • Furuse M.
      • Hata M.
      • Furuse K.
      • Yoshida Y.
      • Haratake A.
      • Sugitani Y.
      • et al.
      Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice.
      ,
      • Rubsam M.
      • Mertz A.F.
      • Kubo A.
      • Marg S.
      • Jungst C.
      • Goranci-Buzhala G.
      • et al.
      E-cadherin integrates mechanotransduction and EGFR signaling to control junctional tissue polarization and tight junction positioning.
      ), immunostaining analysis in wild-type animals revealed intensive staining of the TJ-specific protein occludin in the granular layer (Figure 2d). In contrast, in Dsg1–/– mice occludin staining was largely absent (Figure 2d). Interestingly, although the stratum granulosum was present in the three Dsg1+/– mice, which died within 24 hours after birth, tight junction integrity was severely altered as indicated by ragged, discontinuous occludin staining, suggesting that epidermal barrier function was compromised in these animals as well (Figure 2d). In addition, except for the slight increase in claudin 1 in knockout mice, the distribution and expression patterns of other tight junction proteins resembled those of wild-type and heterozygous pups (Supplementary Figure S1a, S1b).
      Figure thumbnail gr2
      Figure 2Characterization of the epidermis of newborn Dsg1 null mice. (a) Hematoxylin and eosin–stained skin cross sections revealed superficial epidermal splitting only in Dsg1–/–, (asterisks indicate blister cavities), scale bar = 75 μm, n = 3. (b) In toluidine blue penetration assay, the skin of Dsg1–/–, but not of Dsg1+/+ and Dsg1+/–, littermates was stained, demonstrating epidermal barrier loss. n = 3. (c) Immunostaining for Dsg1, Dsg3, and E-cadherin shows that Dsg1 depletion did not alter expression patterns of Dsg3 or E-cadherin (asterisk displays blister cavity), scale bar = 25 μm, n = 3. (d) When compared to wild-type mice, occludin immunostaining was largely lost in Dsg1–/– and fragmented in Dsg1+/– littermates. To visualize skin layers, F-actin was labeled with phalloidin and nuclei were visualized with DAPI, scale bar = 25 μm, n = 3. Dsg, desmoglein.
      Taken together, these data demonstrate that Dsg1 is crucial for epidermal integrity and barrier function. Complete loss of Dsg1 causes a lethal pemphigus phenotype, indicating that autoantibody-induced inactivation of Dsg1 in pemphigus is sufficient to cause skin blistering.

      Materals and Methods

      Refer to the Supplementary Materials online.
      All animals were kept under conditions that conformed to the regulations and the permission of the Government of Upper Bavaria, (Az. 55.2-2532.Vet_02-14-139), Germany. All experiments were performed in accordance with the relevant guidelines and regulations.

      Conflict of Interests

      The authors state no conflict of interest.

      Acknowledgments

      The authors thank Sabine Mühlsimer, Jessica Plewa, Martina Hitzenbichler, and Kathleen Plietz for the excellent technical assistance.

      Author Contributions

      Study concept and design: JW. Acquisition of data: DK. Analysis and interpretation of data: DK, MYR, VS, and JW. Writing of the manuscript and preparation of figures: DK, MYR, and JW. Critical revision of the manuscript for important intellectual content: DK, MYR, VS, and JW. All authors reviewed the manuscript.

      Supplementary Materials

      Generation of knock-out Dsg1 a-c mouse model

      The Desmoglein 1 alpha to gamma (Dsg1a-c) knock-out mouse was generated using a CRISPR/Cas9 system. The Dsg1a-c cluster consists of three neighbouring a-c genes located on mouse chromosome 18 where Dsg1b and c flank/border the Dsg1a gene region. Deletion of Dsg1a- Dsg1c locus was achieved by designing single-chain guide (sg) RNA sequences flanking the Dsg1c and b form. Each gsRNA was defined as 20 bp of gene specific sequence followed by a so called PAM motive (NGG). A publicly available algorithm from Institut des Neurosciences (http://crispor.tefor.net/) was utilized to select the desired gene specific sequences. The sequences picked up for Dsg1c and Dsg1b were inserted into a CRISPR expression vector containing also a coding sequence for Caspase 9 nuclease. The resulting four constructs were injected into fertilized mouse oocytes derived from C57B1/6N mice (Charles River WIGA Sulzfeld). The surviving oocytes were transferred into foster mothers. Subsequent genotyping of the F1 generation identified an offspring with deletion of the entire Dsg1 locus. The latter were used for further breeding and analyses.

      Ex utero preparation

      The day after mating, female mice were checked for the presence of a vaginal plug. This day was counted as embryonic day 0.5 (E0.5). At E20 the uterus was dissected and the embryos were collected. Further determination of the genotype was performed following the genotyping protocol.

      Genotyping protocol

      Experimental crosses were performed by breeding parental male and female Dsg1a-c -/+ heterozygotes mice. Confirmation of their genotype was achieved by PCR with DNA extracted from tail or ear biopsies using hot sodium hydroxide and Tris, according to the protocol (
      • Truett G.E.
      • Heeger P.
      • Mynatt R.L.
      • Truett A.A.
      • Walker J.A.
      • Warman M.L.
      Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).
      ). Set of screening primers FW: GGTTGTTTAACTTTTCCATTTTGACAGT and REV: GGATTCGGGTTTTACTTGTCAATATC generated a product of 793 bp indicative of the presence of mutant (Dsg1a-Dsg1c knock-out) allele. The second primer set (FW: CTTGTGGTGAGAGGCTCAGAC, REV: CTGGAACAAGAGGCAAAGTATCAGC) was utilized for amplification of 407 bp product validating the existence of wild type Dsg1a-Dsg1c allele. The 407 bp DNA fragment is part of the Dsg1 locus deleted during CRISPR/Cas9 targeting. Simultaneous manifestation of both PCR products reveals the existence of heterozygote animals.
      Nested PCRs with both set of primers was carried out as follow: initial denaturation of 3 min at 95°C, followed by 39 cycles at 95°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min. Final extension at 72°C for 10 min completed the PCR.

      Antibodies

      In the present study, the following antibodies were used: mouse-anti-Dsg 1+2 antibody (Progen Biotechnology, Heidelberg, Germany); mouse-anti-Dsg3 AK18 antibody (MBL International Corporation, Woburn, MA, USA); mouse E-Cadherin antibody (BD Transduction, Heidelberg, Germany); rabbit-anti-occludin antibody (Thermo Fisher Scientific, (Germering, Germany); rabbit-anti-claudin 1 antibody (ThermoFisher Scientific); rabbit-anti-claudin 5 antibody (Abcam); rabbit-anti-desmoplakin (NW6) antibody (kindly provided by Kathleen Green (Northwestern University, Chicago. IL); (
      • Roberts B.J.
      • Johnson K.E.
      • McGuinn K.P.
      • Saowapa J.
      • Svoboda R.A.
      • Mahoney M.G.
      • et al.
      Palmitoylation of plakophilin is required for desmosome assembly.
      )); rabbit-anti-desmocollin 1 (Dsc 1) antibody (Abcam); rabbit-anti-desmocollin 3 (Dsc 3) antibody (LifeSpan BioSciences); mouse-anti-plakoglobin (PG) antibody (Progene); rabbit-anti-zonula occludens 1 (ZO 1) antibody (ThermoFisher Scientific); mouse-anti Glycerinaldehyd-3-phosphat-Dehydrogenase (GAPDH) antibody (Aviva Systems Biology). Filamentous actin (F-actin) was illuminated using an Alexa 488 phalloidin dye (Life Technologies, Karlsruhe, Germany). Staining with 4′.6′-diamidino-2-phenylindole (DAPI) provides visualization of the nucleus. All corresponding secondary antibodies were purchased from Dianova (Hamburg, Germany). Non-specific binding of the secondary antibodies were tested (data not shown).

      Western blot analysis

      Mouse skin tissue lysates were prepared by homogenization in SDS-buffer. The samples were subjected to gel electrophoresis and Western blot according to standard procedures.

      Histology and immunostaining

      Whole mounted sample of mice embryos were embedded in Tissue Tec (Leica Biosystems, Nussloch, Germany). Thereafter the samples were serially sectioned at 7μm thickness using a cryostat microtome (Cyrosstar NX70, Thermo Fisher). Hematoxylin and esoin (H.E.) staining was performed according to the standard protocols (
      • Maria Mulisch U.W.
      Romeis - Mikroskopische Technik.
      ) and mounted in DEPX (Sigma-Aldrich, St. Louis, MO, U.S.A). Images were captured using a Leica DMi8 microscope with a HC PL APO 40x/0.85 Dry objective. For immunofluorescence analysis, the slides were heated for 45 min at 60°C, washed with PBS and fixed with 2% paraformaldehyde in PBS for 20 min. Next, samples were rinsed several times with PBS, permeabilized with 1% Triton X-100 for 60 min and after final washing with PBS, blocked with 3% bovine serum albumin and 1% normal goat serum for 60 min. The primary autoantibodies were incubated overnight at 4°C. After washing with PBS, respective secondary antibodies were applied for 60 min at room temperature. Lastly, slides were mounted with 1.5% n-propyl gallate in glycerol. The images were taken with a Leica SP5 confocal microscope using a 63x/1.40 PL APO oil objective (Leica, Mannheim, Germany).

      Toluidine blue assay

      To assess epidermal barrier integrity, the toluidine blue barrier assay was accomplished as described elsewhere (
      • Schmitz A.
      • Lazi'c E.
      • Koumaki D.
      • Kuonen F.
      • Verykiou S.
      • Rubsam M.
      Assessing the in vivo epidermal barrier in mice: dye penetration assays.
      ). Briefly, sacrificed mice were rinsed in PBS. Subsequently, by immersion in 25, 50, 75, 100, 75, 50 and 25% methanol, skin penetration with toluidine blue was permitted. As next, the pups were rehydrated in PBS, immersed in 0.1% toluidine blue for 10 minutes and again washed with PBS. Blue stained embryos are indicative for the presence of barrier defects, whereas intact barrier will prevent the staining of the skin.
      Figure thumbnail fx1
      Supplementary Figure S1Expression pattern of desmosomal and TJ-associated proteins due to lack of Dsg1. (a) Immunostaining of skin sections from mice with different genotypes revealed no changes in the expression pattern and distribution of desmosomal and TJ-associated proteins, scale bar = 25μm, n=3. (b) Immunoblot analysis of TJ and desmosomal components with corresponding GAPDH loading control, n=3.
      Supplementary Table S1Litters and the ratio of WT (Dsg1+/+), heterozygous (Dsg1+/-) and Dsg1 null mice (Dsg1-/-)
      LitterTotal number of miceDsg 1+/+Dsg 1+/-Dsg 1-/-
      17331
      26231
      34130
      44040
      55131
      67151
      76231
      86132
      98440
      1010352
      Total6318369
      In total 63 mice derived from 10 litters were analyzed.

      References

        • Chen J.
        • Den Z.
        • Koch P.J.
        Loss of desmocollin 3 in mice leads to epidermal blistering.
        J Cell Sci. 2008; 121: 2844-2849
        • Furuse M.
        • Hata M.
        • Furuse K.
        • Yoshida Y.
        • Haratake A.
        • Sugitani Y.
        • et al.
        Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice.
        J Cell Biol. 2002; 156: 1099-1111
        • Heupel W.M.
        • Zillikens D.
        • Drenckhahn D.
        • Waschke J.
        Pemphigus vulgaris IgG directly inhibit desmoglein 3-mediated transinteraction.
        J Immunol. 2008; 181: 1825-1834
        • Kasperkiewicz M.
        • Ellebrecht C.T.
        • Takahashi H.
        • Yamagami J.
        • Zillikens D.
        • Payne A.S.
        • et al.
        Pemphigus. Nat Rev Dis Primers. 2017; 3: 17026
        • Koch P.J.
        • Mahoney M.G.
        • Ishikawa H.
        • Pulkkinen L.
        • Uitto J.
        • Shultz L.
        • et al.
        Targeted disruption of the pemphigus vulgaris antigen (desmoglein 3) gene in mice causes loss of keratinocyte cell adhesion with a phenotype similar to pemphigus vulgaris.
        J Cell Biol. 1997; 137: 1091-1102
        • Mahoney M.G.
        • Wang Z.
        • Rothenberger K.
        • Koch P.J.
        • Amagai M.
        • Stanley J.R.
        Explanations for the clinical and microscopic localization of lesions in pemphigus foliaceus and vulgaris.
        J Clin Invest. 1999; 103: 461-468
        • Rubsam M.
        • Mertz A.F.
        • Kubo A.
        • Marg S.
        • Jungst C.
        • Goranci-Buzhala G.
        • et al.
        E-cadherin integrates mechanotransduction and EGFR signaling to control junctional tissue polarization and tight junction positioning.
        Nat Commun. 2017; 8: 1250
        • Spindler V.
        • Eming R.
        • Schmidt E.
        • Amagai M.
        • Grando S.
        • Jonkman M.F.
        • et al.
        Mechanisms causing loss of keratinocyte cohesion in pemphigus.
        J Invest Dermatol. 2018; 138: 32-37
        • Spindler V.
        • Rotzer V.
        • Dehner C.
        • Kempf B.
        • Gliem M.
        • Radeva M.
        • et al.
        Peptide-mediated desmoglein 3 crosslinking prevents pemphigus vulgaris autoantibody-induced skin blistering.
        J Clin Invest. 2013; 123: 800-811
        • Spindler V.
        • Waschke J.
        Pemphigus—a disease of desmosome dysfunction caused by multiple mechanisms.
        Front Immunol. 2018; 9: 136
        • Tsunoda K.
        • Ota T.
        • Aoki M.
        • Yamada T.
        • Nagai T.
        • Nakagawa T.
        • et al.
        Induction of pemphigus phenotype by a mouse monoclonal antibody against the amino-terminal adhesive interface of desmoglein 3.
        J Immunol. 2003; 170: 2170-2178
        • Vielmuth F.
        • Rotzer V.
        • Hartlieb E.
        • Hirneiss C.
        • Waschke J.
        • Spindler V.
        Pemphigus autoantibodies induce blistering in human conjunctiva.
        Invest Ophthalmol Vis Sci. 2016; 57: 4442-4449
        • Walter E.
        • Vielmuth F.
        • Rotkopf L.
        • Sardy M.
        • Horvath O.N.
        • Goebeler M.
        • et al.
        Different signaling patterns contribute to loss of keratinocyte cohesion dependent on autoantibody profile in pemphigus.
        Sci Rep. 2017; 7: 3579
        • Waschke J.
        The desmosome and pemphigus.
        Histochem Cell Biol. 2008; 130: 21-54
        • Waschke J.
        • Bruggeman P.
        • Baumgartner W.
        • Zillikens D.
        • Drenckhahn D.
        Pemphigus foliaceus IgG causes dissociation of desmoglein 1-containing junctions without blocking desmoglein 1 transinteraction.
        J Clin Invest. 2005; 115: 3157-3165
        • Yoshida K.
        • Ishii K.
        • Shimizu A.
        • Yokouchi M.
        • Amagai M.
        • Shiraishi K.
        • et al.
        Non-pathogenic pemphigus foliaceus (PF) IgG acts synergistically with a directly pathogenic PF IgG to increase blistering by p38MAPK-dependent desmoglein 1 clustering.
        J Dermatol Sci. 2017; 85: 197-207