Advertisement

Cigarette Smoke Underlies the Pathogenesis of Palmoplantar Pustulosis via an IL-17A–Induced Production of IL-36γ in Tonsillar Epithelial Cells

  • Author Footnotes
    4 These authors contributed equally to this work.
    Keiju Kobayashi
    Footnotes
    4 These authors contributed equally to this work.
    Affiliations
    Department of Dermatology, School of Medicine, Sapporo Medical University, Sapporo, Japan

    Department of Human Immunology, Research Institute for Frontier Medicine, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Author Footnotes
    4 These authors contributed equally to this work.
    Ryuta Kamekura
    Footnotes
    4 These authors contributed equally to this work.
    Affiliations
    Department of Human Immunology, Research Institute for Frontier Medicine, School of Medicine, Sapporo Medical University, Sapporo, Japan

    Department of Otolaryngology, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Junji Kato
    Affiliations
    Department of Dermatology, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Shiori Kamiya
    Affiliations
    Department of Dermatology, School of Medicine, Sapporo Medical University, Sapporo, Japan

    Department of Human Immunology, Research Institute for Frontier Medicine, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Takafumi Kamiya
    Affiliations
    Department of Dermatology, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Kenichi Takano
    Affiliations
    Department of Otolaryngology, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Shingo Ichimiya
    Affiliations
    Department of Human Immunology, Research Institute for Frontier Medicine, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Hisashi Uhara
    Correspondence
    Correspondence: Hisashi Uhara, Department of Dermatology, School of Medicine, Sapporo Medical University, South-1, West-17, Chuo-ku, Sapporo 060-8543, Japan.
    Affiliations
    Department of Dermatology, School of Medicine, Sapporo Medical University, Sapporo, Japan
    Search for articles by this author
  • Author Footnotes
    4 These authors contributed equally to this work.
Open ArchivePublished:November 11, 2020DOI:https://doi.org/10.1016/j.jid.2020.09.028
      Palmoplantar pustulosis (PPP) is characterized by sterile pustules on the palms and soles. A strong association between PPP and tobacco smoking has been reported, and it has been speculated that the IL-17A pathway may play an important role in PPP. Recent studies have suggested that IL-36 plays a pivotal role in the pathogenesis of psoriasis and its subtypes. The relationships among IL-36, smoking, and PPP have not been examined. Here, we investigated the relationships among the smoking index, severity of the clinical condition of PPP, and in vitro dynamics of IL-36 in human tonsillar epithelial cells under the condition of exposure to a cigarette smoke extract. The results demonstrated that the Palmoplantar Pustulosis Area and Severity Index was strongly and positively correlated with the smoking index in female patients. Immunohistochemical examinations showed that IL-36γ was highly expressed in tonsillar epithelial cells from patients with PPP but not in those from patients with recurrent tonsillitis without PPP. The in vitro study revealed that IL-17A synergistically induced a release of IL-36γ under cigarette smoke extract exposure. These results suggest that local production of IL-36γ by epithelial cells induced by cigarette smoke exposure plays an important role in the pathogenesis of PPP.

      Abbreviations:

      CSE (cigarette smoke extract), PPP (palmoplantar pustulosis), PPPASI (Palmoplantar Pustulosis Area and Severity Index), SI (smoking index)

      Introduction

      Palmoplantar pustulosis (PPP) is characterized by eruptions of sterile pustules and erythematosus plaques on the palms and soles (
      • Yamamoto T.
      Clinical characteristics of Japanese patients with palmoplantar pustulosis.
      ). Most patients with PPP are smokers at the time of their disease onset (
      • Miot H.A.
      • Miot L.D.
      • Lopes P.S.
      • Haddad G.R.
      • Marques S.A.
      Association between palmoplantar pustulosis and cigarette smoking in Brazil: a case-control study.
      ), and the cessation of smoking improves the disease condition (
      • Michaëlsson G.
      • Gustafsson K.
      • Hagforsen E.
      The psoriasis variant palmoplantar pustulosis can be improved after cessation of smoking.
      ), indicating that smoking is a major risk factor of PPP. Since the first description of a direct relationship between PPP and focal infection (
      • Andrews G.C.
      • Machacek G.F.
      Pustular bacterids of the hands and feet.
      ), tonsillectomy has been a commonly applied treatment for PPP in Japan (
      • Takahara M.
      • Hirata Y.
      • Nagato T.
      • Kishibe K.
      • Katada A.
      • Hayashi T.
      • et al.
      Treatment outcome and prognostic factors of tonsillectomy for palmoplantar pustulosis and pustulotic arthro-osteitis: a retrospective subjective and objective quantitative analysis of 138 patients.
      ). The treatment of odontogenic infection also helps improve PPP (
      • Kouno M.
      • Nishiyama A.
      • Minabe M.
      • Iguchi N.
      • Ukichi K.
      • Nomura T.
      • et al.
      Retrospective analysis of the clinical response of palmoplantar pustulosis after dental infection control and dental metal removal.
      ). It is thus rational to investigate the influence of cigarette smoke on the oral mucosal epithelium.
      Recent studies suggested that PPP, generalized pustular psoriasis, and acute generalized exanthematous pustulosis are commonly characterized by unique molecular alterations associated with IL-36–induced neutrophilic inflammation (
      • Arakawa A.
      • Vollmer S.
      • Besgen P.
      • Galinski A.
      • Summer B.
      • Kawakami Y.
      • et al.
      Unopposed IL-36 activity promotes clonal CD4+ T-cell responses with IL-17A production in generalized pustular psoriasis.
      ;
      • Johnston A.
      • Xing X.
      • Wolterink L.
      • Barnes D.H.
      • Yin Z.
      • Reingold L.
      • et al.
      IL-1 and IL-36 are dominant cytokines in generalized pustular psoriasis.
      ;
      • Liang Y.
      • Xing X.
      • Beamer M.A.
      • Swindell W.R.
      • Sarkar M.K.
      • Roberts L.W.
      • et al.
      Six-transmembrane epithelial antigens of the prostate comprise a novel inflammatory nexus in patients with pustular skin disorders.
      ;
      • Meier-Schiesser B.
      • Feldmeyer L.
      • Jankovic D.
      • Mellett M.
      • Satoh T.K.
      • Yerly D.
      • et al.
      Culprit drugs induce specific IL-36 overexpression in acute generalized exanthematous pustulosis.
      ). IL-36 is a collective name for three members of the IL-1 superfamily: IL-36α, IL-36β, and IL-36γ (
      • Sims J.E.
      • Smith D.E.
      The IL-1 family: regulators of immunity.
      ;
      • Towne J.E.
      • Sims J.E.
      IL-36 in psoriasis.
      ). These IL-36 family members are produced by a variety of cell types, with abundant expression in epithelial cells (
      • Towne J.E.
      • Sims J.E.
      IL-36 in psoriasis.
      ). IL-36 synergizes with IL-17A to increase the expression of IL-36 itself in human epidermal keratinocytes (
      • Pfaff C.M.
      • Marquardt Y.
      • Fietkau K.
      • Baron J.M.
      • Lüscher B.
      The psoriasis-associated IL-17A induces and cooperates with IL-36 cytokines to control keratinocyte differentiation and function.
      ). IL-17A activates proinflammatory signaling pathways by binding to specific receptors, such as IL-17RA and IL-17RC (
      • Hot A.
      • Zrioual S.
      • Toh M.L.
      • Lenief V.
      • Miossec P.
      IL-17A- versus IL-17F-induced intracellular signal transduction pathways and modulation by IL-17RA and IL-17RC RNA interference in rheumatoid synoviocytes.
      ), which are involved in driving IL-36 expression in human psoriasis skin lesions (
      • Carrier Y.
      • Ma H.L.
      • Ramon H.E.
      • Napierata L.
      • Small C.
      • O'Toole M.
      • et al.
      Inter-regulation of Th17 cytokines and the IL-36 cytokines in vitro and in vivo: implications in psoriasis pathogenesis.
      ). In light of these reports, it appears that IL-36 potentially plays an important role in the pathogenesis of PPP. However, the mechanisms underlying the production of IL-36 and the involvement of IL-36 in PPP remain poorly understood.
      Cigarette smoke is composed of more than 7,000 chemicals, including nicotine, carbon monoxide, nitrogen oxides, and heavy metals (
      • Gunes S.
      • Metin Mahmutoglu A.
      • Arslan M.A.
      • Henkel R.
      Smoking-induced genetic and epigenetic alterations in infertile men.
      ;
      • Rennard S.I.
      Cigarette smoke in research.
      ;
      • Talhout R.
      • Schulz T.
      • Florek E.
      • van Benthem J.
      • Wester P.
      • Opperhuizen A.
      Hazardous compounds in tobacco smoke.
      ). Numerous studies have suggested that cigarette smoke extract (CSE) enhances or suppresses the expression of many genes in human epithelial cells (
      • Mallampalli R.K.
      • Li X.
      • Jang J.H.
      • Kaminski T.
      • Hoji A.
      • Coon T.
      • et al.
      Cigarette smoke exposure enhances transforming acidic coiled-coil-containing protein 2 turnover and thereby promotes emphysema.
      ;
      • Zeng N.
      • Wang T.
      • Chen M.
      • Yuan Z.
      • Qin J.
      • Wu Y.
      • et al.
      Cigarette smoke extract alters genome-wide profiles of circular RNAs and mRNAs in primary human small airway epithelial cells.
      ). However, CSE-associated production of IL-36 in human epithelial cells has not been reported. Herein, we investigated the relationship between a smoking index (SI) (which we defined as the number of cigarettes smoked per day multiplied by the number of years smoking) and the PPP Area and Severity Index (PPPASI). We also cultured epithelial cells derived from human tonsils and nasal mucosa under exposure to a CSE and determined the gene and protein expressions.

      Results

      PPPASI and SI had a strong positive correlation in the female patients with PPP

      To assess the effects of tobacco smoking on PPP, we first investigated the relationship between all of the patients' smoking histories (i.e., whether they were never-smokers, second-hand smokers, ex-smokers, or current smokers) and their PPPASI scores (among the ex-smokers [n = 13], a median of 7 years [range, 2–10 years] had passed since they quit smoking). The PPPASI score and SI were evaluated in 45 patients (Table 1). In the ex-smokers and current smokers, the medians of the PPPASI score were 13.6 (range, 7–22.6) and 10.9 (6.1–21.4), and the medians of the SI were 525 (400–800) and 595 (300–640), respectively. The PPPASI scores of the ex-smokers and current smokers were significantly higher than those of the nonsmokers. There were no significant differences in PPPASI or SI between the ex-smokers and the current smokers (Figure 1a).
      Table 1Characteristics of Patients with PPP
      CharacteristicsPPP (n = 45), n (%)
      Sex
       Male13 (28.9%)
       Female32 (71.1%)
      Age (y), mean ± SD56.8 ± 11.9
      BMI (kg/m2), mean ± SD
       All patients (n = 37)23.4 ± 3.2
       Male patients (n = 10)23.2 ± 1.5
       Female patients (n = 27)23.5 ± 3.6
      Extra-palmoplantar lesion6 (13.3%)
      Smoking habit
       Never smoker
      Has never smoked in the past and is not regularly exposed to second-hand smoke.
      2 (4.4%)
      Male0
      Female2
       Second-hand smoker7 (15.6%)
      Male0
      Female7
       Ex-smoker13 (28.9%)
      Male4
      Female9
       Current smoker23 (51.1%)
      Male9
      Female14
      Smoking index, mean ± SD
       All patients (n = 45)472.0 ± 420.5
       Male patients (n = 13)825.6 ± 494.5
      P < 0.01 between the mean smoking index of the male and female patients.
       Female patients (n = 32)328.4 ± 279.2
       Never smoker
      Has never smoked in the past and is not regularly exposed to second-hand smoke.
      (n = 2)
      0
       Second-hand smoker (n = 7)0
       Ex-smoker (n = 13)695.2 ± 479.3
       Current smoker (n = 23)534.6 ± 316.2
      PPPASI, mean ± SD
       All patients (n = 45)12.9 ± 10.5
       Male patients (n = 13)12.5 ± 9.3
       Female patients (n = 32)13.1 ± 10.9
       Never smoker
      Has never smoked in the past and is not regularly exposed to second-hand smoke.
      (n = 2)
      2.3 ± 1.9
       Second-hand smoker (n = 7)5.8 ± 3.8
       Ex-smoker (n = 13)15.0 ± 9.9
       Current smoker (n = 23)14.8 ± 11.2
      Abbreviations: BMI, body mass index; PPP, palmoplantar pustulosis; PPPASI, Palmoplantar Pustulosis Area and Severity Index.
      1 Has never smoked in the past and is not regularly exposed to second-hand smoke.
      2 P < 0.01 between the mean smoking index of the male and female patients.
      Figure thumbnail gr1
      Figure 1The relationship between PPPASI and tobacco smoking. (a) Comparison of PPPASI scores in the 45 patients with PPP separated into three categories: nonsmokers (n = 9) divided into never-smokers (n = 2) and second-hand smokers (n = 7); ex-smokers (n = 13); and current smokers (n = 23). ∗P < 0.05. Data are mean ± SD. (b) The correlation between PPPASI and SI (13 males, 32 females). (c) PPPASI in the male patients plotted against SI values (n = 13). (d) PPPASI in the female patients plotted against SI (n = 32). PPP, Palmoplantar Pustulosis; PPPASI, Palmoplantar Pustulosis Area and Severity Index; SI, smoking index
      We next examined the relationship between PPPASI and SI in the patients with PPP. Although there was no correlation between PPPASI and SI in the series of all patients or in the group of males (Figure 1b and c), there was a significant correlation in the female group (Figure 1d).

      The male-to-female ratio of PPP might correspond to the male-to-female ratio of smoking prevalence in Japan

      We next investigated the differences in the male-to-female ratios of patients with PPP and the general smoking frequency. The male-to-female ratios of PPP at our hospital (Hokkaido), two hospitals in other prefectures of Japan (Fukushima, Gifu), and all of Japan are 1:3.18, 1:2.09, 1:1.31, and 1:1.89, respectively (Supplementary Table S1) (
      • Akiyama T.
      • Seishima M.
      • Watanabe H.
      • Nakatani A.
      • Mori S.
      • Kitajima Y.
      The relationships of onset and exacerbation of pustulosis palmaris et plantaris to smoking and focal infections.
      ;
      • Hiraiwa T.
      • Yamamoto T.
      Comorbidities of Japanese patients with palmoplantar pustulosis: a report from a single center.
      ;
      • Kubota K.
      • Kamijima Y.
      • Sato T.
      • Ooba N.
      • Koide D.
      • Iizuka H.
      • et al.
      Epidemiology of psoriasis and palmoplantar pustulosis: a nationwide study using the Japanese national claims database.
      ). The male-to-female ratios of general smoking frequency (2016) at these four places are 1:0.47, 1:0.31, 1:0.20, and 1:0.31, respectively (Supplementary Table S2; Cancer Information Service, National Cancer Center, Japan). The prevalence of smoking among women was the highest in Hokkaido and the lowest in Gifu, which seems to correspond to the male-to-female ratio of PPP. The smoking prevalences of the men at each of the four places are higher than those of the women, with a similar tendency.

      CSE upregulated the expression of IL17RA and IL17RC in human tonsillar epithelial cells, and the upregulation was dependent on phosphatidylinositol 3-kinase and protein kinase B activation

      To investigate how smoking tobacco is involved in the onset and subsequent exacerbation of PPP, we tested the direct effects of CSE on tonsillar epithelial cells. CSE induced significant upregulations of the transcription of IL17RA (1.8-fold, P = 0.0046), IL17RC (1.3-fold, P = 0.0335), and IL17RE (1.2-fold, P = 0.0172) in tonsillar epithelial cells (Figure 2a). Nicotine, which is one of the toxic ingredients in cigarette smoke, did not induce upregulations of IL17RA, IL17RC, or IL17RE (Figure 2a). The CSE-induced IL17RA and IL17RC upregulation was inhibited by the phosphatidylinositol 3-kinase inhibitor LY294002 (Figure 2b). The CSE-induced IL17RA and IL17RC upregulation was not inhibited by the MAPK kinase inhibitor PD98059 or by SB203580 (an inhibitor of p38 MAPK) (Figure 2c and d). These findings suggest that the phosphatidylinositol 3-kinase/protein kinase B pathway mediated the induction of IL-17 receptors by CSE.
      Figure thumbnail gr2
      Figure 2CSE upregulated the expression of IL-17R with dependence on PI3K/Akt activation. (a) Results of the quantitative RT-PCR to determine the mRNA levels of IL17RA, IL17RC, and IL17RE in epithelial cells treated with 0.5% and 1% CSE or 20 μM nicotine for 12 hours. Error bars: SD of the mean of 4–9 experiments. (b–d) Epithelial cells from patients pretreated with (b) 10 μM PI3K/Akt inhibitor (LY294002), (c) 10 μM MEK inhibitor (PD98059), or (d) 10 μM p38 MAPK inhibitor (SB203580) for 30 minutes and then stimulated with 1% CSE for 12 hours. Error bars: SD of the mean of 4–6 independent experiments. ∗P < 0.05, ∗∗P < 0.01. Akt, protein kinase B; CSE, cigarette smoke extract; MEK, MAPK kinase; n.s., not significant; PI3K, phosphatidylinositol 3-kinase.

      CSE synergistically enhanced IL-17A–induced IL-36 production in tonsillar epithelial cells via an upregulation of IL-17R

      We next investigated the effect of CSE on IL-17A–induced proinflammatory cytokines associated with the upregulation of IL17RA/RC in tonsillar epithelial cells. The treatment with IL-17A alone led to a slight-to-moderate increase in the mRNA levels of IL36A, IL36B, IL36G, IL36RN, and IL8, but the cotreatment with IL-17A + CSE synergistically enhanced the mRNA levels of these cytokines (Figure 3a). Compared with the treatment with only IL-17A, the transcriptional upregulations with CSE + IL-17A cotreatment were as follows: IL36A, 2.09-fold; IL36B, 1.80-fold; IL36G, 3.25-fold; IL36RN, 4.95-fold; and IL8, 3.09-fold higher. The IL-17A–induced production of IL-36 from tonsillar epithelial cells was also significantly increased at the protein level (Figure 3b). Compared with the treatment with only IL-17A, the IL-36α protein upregulation was 2.22-fold higher (162 vs. 73 pg/ml) and the IL-36γ protein upregulation was 1.67-fold higher (242 vs. 145 pg/ml) with the CSE + IL-17A cotreatment. Similar results were obtained from human nasal epithelial cells and human epidermal keratinocytes (Supplementary Figures S1 and S2). At the same time, however, we observed that the mRNA expressions of IL17RA, IL17RC, IL17RE, IL36 family, IL36RN, IL17A, and IL8 derived from primary tonsillar epithelial cells of patients with PPP were not continuously upregulated compared with those from patients without PPP (Supplementary Figure S3).
      Figure thumbnail gr3
      Figure 3IL-17A synergistically upregulated the expression of IL-36 in the presence of CSE in human tonsillar epithelial cells. (a) Results of the quantitative RT-PCR to determine the mRNA levels of the IL36 family members, IL36RN, and IL8. Epithelial cells were treated with 1% CSE in the presence or absence of 100 ng/ml IL-17A for 24 hours. One representative result from three independent experiments is shown Data are mean ± SD (n = 3). (b) IL-36α and IL-36γ concentrations in cell culture media as evaluated by ELISA. Epithelial cells were treated with CSE in the presence or absence of 100 ng/ml IL-17A for 72 hours. One representative result from three independent experiments is shown Data are mean ± SD (n = 3). ∗P < 0.05 versus control. CSE, cigarette smoke extract.

      A significant presence of IL-36γ in the tonsillar epithelium, but not in the serum, of the patients with PPP was verified by immunohistology

      To evaluate the expression of IL-36 in tonsil tissues, we performed an immunohistochemical examination using surgically resected tonsil specimens from non-PPP patients and patients with PPP. IL-36 expression was observed in the upper layer of the tonsillar epithelium in both the non-PPP patients and patients with PPP (Figure 4a–d). IL-36γ was highly expressed in tonsils from the patients with PPP (P = 0.0019; Figure 4e) compared with those from the non-PPP patients. Although there was no significant difference in the IL-36α expression levels between the non-PPP patients and patients with PPP (P = 0.3011), the IL-36α expression levels in the tonsils from the patients with PPP tended to be generally higher (Figure 4e). However, the serum levels of IL-36 were not significantly increased in the patients with PPP compared with those in healthy controls (Figure 4f).
      Figure thumbnail gr4
      Figure 4IL-36 in tonsils from patients with PPP was highly expressed predominantly in upper layers compared with that in tonsils from non-PPP patients, but it was not increased in the serum of patients with PPP. (a–d) Representative distributions of IL-36 staining in the surface and upper layers of tonsils from all patients. Bar = 200 μm. (a, b) Immunohistochemical staining for IL-36α in tonsils. (c, d) Immunohistochemical staining for IL-36γ in tonsils. (e) Immunostaining indexes (calculated as shown in ) for IL-36α and IL-36γ of the non-PPP patients and patients with PPP. (f) The serum levels of IL-36α in non-PPP patients (n = 20) and patients with PPP (n = 30) and the serum levels of IL-36γ in non-PPP patients (n = 22) and patients with PPP (n = 28). ∗∗P < 0.01. n.s., not significant; PPP, palmoplantar pustulosis.

      Discussion

      The results of this study demonstrated that PPPASI (an indicator of skin severity) and SI were correlated in the female patients but not the male patients, although the SI scores were significantly higher in the male patients than the female patients (P = 0.0050) (Table 1). Moreover, the prevalence of smoking among the women seemed to correspond to the male-to-female ratio of PPP in each area of Japan, although the smoking prevalence of the men was higher than that of the women.
      It is unclear why PPPASI and the male-to-female ratio are influenced by a smoking habit more strongly in women than men; however, sex-based immunological differences might be involved (
      • Klein S.L.
      • Flanagan K.L.
      Sex differences in immune responses.
      ), because smoking is known as the most important environment risk factor associated with the development of rheumatoid arthritis — an autoimmune disease that develops predominantly in middle-aged women (
      • Scherer H.U.
      • Häupl T.
      • Burmester G.R.
      The etiology of rheumatoid arthritis.
      ). Future studies should examine the effect of smoking in terms of immunology to clarify the sex differences in susceptibility among patients with PPP.
      In this study, 15.6% (n = 7) of the patients with PPP were second-hand smokers; notably, all were female (Table 1). Previous investigations demonstrated that PPP was observed more frequently in women than men, although the smoking rate is higher in men than women. Second-hand smokers were excluded from the smoking group in previous studies, but exposure to second-hand smoke can lead to adverse outcomes, especially in children (
      • Vardavas C.I.
      • Plada M.
      • Tzatzarakis M.
      • Marcos A.
      • Warnberg J.
      • Gomez-Martinez S.
      • et al.
      Passive smoking alters circulating naïve/memory lymphocyte T-cell subpopulations in children.
      ) and young women (
      • Aurrekoetxea J.J.
      • Murcia M.
      • Rebagliato M.
      • Fernández-Somoano A.
      • Castilla A.M.
      • Guxens M.
      • et al.
      Factors associated with second-hand smoke exposure in non-smoking pregnant women in Spain: self-reported exposure and urinary cotinine levels.
      ;
      • Kum-Nji P.
      • Meloy L.
      • Keyser-Marcus L.
      Tobacco smoke exposure as a risk factor for human papillomavirus infections in women 18–26 years old in the United States.
      ;
      • Ngo C.Q.
      • Phan P.T.
      • Vu G.V.
      • Chu H.T.
      • Nguyen T.T.
      • Nguyen M.H.
      • et al.
      Prevalence and sources of second-hand smoking exposure among non-smoking pregnant women in an urban setting of Vietnam.
      ). Our finding thus suggests that second-hand smoke should be considered an important risk factor of PPP.
      Our results also revealed that the costimulation of human epithelial cells with CSE + IL-17A significantly increased the production of IL-17A–induced cytokines via an upregulation of IL-17R (Figures 2a and 3), which is consistent with a previous report (
      • Lee K.H.
      • Lee C.H.
      • Woo J.
      • Jeong J.
      • Jang A.H.
      • Yoo C.G.
      Cigarette smoke extract enhances IL-17A-induced IL-8 production via up-regulation of IL-17R in human bronchial epithelial cells.
      ). In another study, the IL-17A pathway was activated in the skin lesions of PPP (
      • Bissonnette R.
      • Fuentes-Duculan J.
      • Mashiko S.
      • Li X.
      • Bonifacio K.M.
      • Cueto I.
      • et al.
      Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway.
      ). Thus, IL-17A might induce and cooperate with IL-36 in patients with PPP as well as those with psoriasis.
      Our primary culture examination revealed that there were no significant differences in the levels of transcripts of IL-17RA, IL-17RC, IL-17RE, IL-36 family, IL-36RN, and IL-8 between the patients with PPP and non-PPP patients (Supplementary Figure S3). This may be due to the absence of IL-17A or CSE-free cultivation for 1 week before the sampling of primary cultured cells in vitro. This 1-week period of nonexposure to IL-17A or CSE may have caused a decrease in the expression levels of these genes, as reflected by our results. These gene expressions in tonsillar epithelial cells may therefore have been more influenced by surrounding conditions rather than each patient's original medical background.
      The immunohistological examination revealed the significant expression of IL-36γ in the tonsillar epithelial cells from patients with PPP (Figure 4c–e), suggesting that IL-36 production as a result of a smoking habit might occur in tonsil tissues. However, the serum IL-36 levels of the patients with PPP of any severity were comparable with those of the healthy controls. In contrast,
      • D'Erme A.M.
      • Wilsmann-Theis D.
      • Wagenpfeil J.
      • Hölzel M.
      • Ferring-Schmitt S.
      • Sternberg S.
      • et al.
      IL-36γ (IL-1F9) is a biomarker for psoriasis skin lesions.
      showed that the IL-36γ serum levels of patients with psoriasis were closely correlated with their disease activity. PPP may thus be a local IL-36γ–associated inflammatory disease rather than a systemic inflammatory disease such as psoriasis.
      The recent reports of treatment for PPP using an anti–IL-23 antibody (
      • Terui T.
      • Kobayashi S.
      • Okubo Y.
      • Murakami M.
      • Zheng R.
      • Morishima H.
      • et al.
      Efficacy and safety of guselkumab in Japanese patients with palmoplantar pustulosis: a phase 3 randomized clinical trial.
      ) and an anti–IL-17A antibody (
      • Mrowietz U.
      • Bachelez H.
      • Burden A.D.
      • Rissler M.
      • Sieder C.
      • Orsenigo R.
      • et al.
      Secukinumab for moderate-to-severe palmoplantar pustular psoriasis: results of the 2PRECISE study.
      ) emphasized the pivotal role of the IL-23/T helper type 17 pathway in the pathogenesis of PPP. However, in a clinical trial using an anti–IL-17A antibody for PPP, the clinical outcome was less favorable than expected compared with the treatment's effects on psoriasis (
      • Mrowietz U.
      • Bachelez H.
      • Burden A.D.
      • Rissler M.
      • Sieder C.
      • Orsenigo R.
      • et al.
      Secukinumab for moderate-to-severe palmoplantar pustular psoriasis: results of the 2PRECISE study.
      ). Pustule formation in PPP is observed mainly at the sites of acrosyringium (
      • Murakami M.
      • Ohtake T.
      • Horibe Y.
      • Ishida-Yamamoto A.
      • Morhenn V.B.
      • Gallo R.L.
      • et al.
      Acrosyringium is the main site of the vesicle/pustule formation in palmoplantar pustulosis.
      ), which is associated with the overexpressions of IL-36γ and IL-8 (
      • Xiaoling Y.
      • Chao W.
      • Wenming W.
      • Feng L.
      • Hongzhong J.
      Interleukin (IL)-8 and IL-36γ but not IL-36Ra are related to acrosyringia in pustule formation associated with palmoplantar pustulosis.
      ). Our results also demonstrated that these cytokines are synergistically induced under the costimulation of CSE + IL-17A in human epithelial cells (Figure 3). However, the cytokines are also induced by an antimicrobial peptide such as LL-37 or TLN-58 (
      • Li N.
      • Yamasaki K.
      • Saito R.
      • Fukushi-Takahashi S.
      • Shimada-Omori R.
      • Asano M.
      • et al.
      Alarmin function of cathelicidin antimicrobial peptide LL37 through IL-36γ induction in human epidermal keratinocytes.
      ;
      • Murakami M.
      • Kameda K.
      • Tsumoto H.
      • Tsuda T.
      • Masuda K.
      • Utsunomiya R.
      • et al.
      TLN-58, an additional hCAP18 processing form, found in the lesion vesicle of palmoplantar pustulosis in the skin.
      ), suggesting that PPP could not be as well controlled as psoriasis by anti–IL-17A antibody. Ongoing clinical trials of PPP are devoted to targeting IL-36 pathways that might enable the management of PPP (
      • Misiak-Galazka M.
      • Zozula J.
      • Rudnicka L.
      Palmoplantar pustulosis: recent advances in etiopathogenesis and emerging treatments.
      ).
      The following study limitation should be considered. First, we could not adjust the presence or absence of treatment for the comparison of the PPPASI values of the smokers and nonsmokers because of the limited number of PPP cases in this study. Variations in the treatment regimen might thus have confounded the results of our analyses. Second, although smoking induces an overexpression of IL-36γ in the tonsillar epithelial cells of patients with PPP, it remains unclear whether this condition is involved in the localized palmoplantar skin lesions. A tonsil–palmoplantar skin axis might be involved in the pathogenesis of PPP (
      • Harabuchi Y.
      • Takahara M.
      Pathogenic role of palatine tonsils in palmoplantar pustulosis: a review.
      ;
      • Mrowietz U.
      • van de Kerkhof P.C.
      Management of palmoplantar pustulosis: do we need to change?.
      ). Cigarette smoke ingredients dissolved in the blood circulation might enhance an IL-17A–induced production of proinflammatory cytokines in palmoplantar acrosyringium lesions. In addition, smoking upregulates IL-8 by its component benzo(a)pyrene via the aryl hydrocarbon receptor (
      • Tsuji G.
      • Takahara M.
      • Uchi H.
      • Takeuchi S.
      • Mitoma C.
      • Moroi Y.
      • et al.
      An environmental contaminant, benzo(a)pyrene, induces oxidative stress-mediated interleukin-8 production in human keratinocytes via the aryl hydrocarbon receptor signaling pathway.
      ). IL-8–dependent neutrophil-derived proteases yield a truncated active form of IL-36 (
      • Henry C.M.
      • Sullivan G.P.
      • Clancy D.M.
      • Afonina I.S.
      • Kulms D.
      • Martin S.J.
      Neutrophil-derived proteases escalate inflammation through activation of IL-36 family cytokines.
      ) (Figure 5). Further examinations are necessary to obtain direct evidence regarding whether cigarette smoke ingredients in a patient's bloodstream induce IL-36γ production in primary palmoplantar acrosyringium keratinocytes.
      Figure thumbnail gr5
      Figure 5Hypothetical model showing the effects of cigarette smoking in patients with PPP. Tonsil, bronchial, and alveolar epithelial cells are directly exposed to tobacco smoke (black continuous arrow). IL-36γ is highly expressed in the tonsil epithelial cells of PPP patients as a result of a long-term smoking history. However, it is unclear whether this condition is involved in the pathogenesis of PPP (dashed arrow). Although IL-36γ levels in peripheral blood are not increased, overexpressions of IL-8 and IL-36γ in palmoplantar areas might also be caused by cigarette smoke ingredients dissolved in the blood circulation (red continuous arrow). The cleavage of full-length IL-36γ is mediated by neutrophil-derived proteinase 3 and cathepsin G. This may lead to a vicious cycle in the pustular microenvironment, which might play a key role in the pathogenesis of PPP. PPP, palmoplantar pustulosis.
      The main findings in our study are that (i) smoking is involved in both the onset and the subsequent severity of PPP, especially in women, and (ii) stimulation with CSE significantly increased the expression of IL-36 in tonsillar epithelial cells. A focus on controlling smoking habits and epithelial cell–derived IL-36 as a promising therapeutic target may be a viable strategy to prevent the development of PPP. Our findings provide an opportunity for more targeted treatments of this disease.

      Materials and Methods

      Patients with PPP

      A total of 184 patients visited Sapporo Medical University Hospital between January 2014 and March 2020. Detailed medical information was obtained; both a detailed smoking history and clinical photographs were available for 45 patients. These 45 patients' characteristics are summarized in Table 1. The symptoms and signs of PPP (erythema, pustules, desquamation) were scored using the PPPASI system (
      • Bhushan M.
      • Burden A.D.
      • McElhone K.
      • James R.
      • Vanhoutte F.P.
      • Griffiths C.E.
      Oral liarozole in the treatment of palmoplantar pustular psoriasis: a randomized, double-blind, placebo-controlled study.
      ). Patients with PPP at the time of their enrollment in this study had undergone the following treatments (duplications are included): corticosteroid ointment or vitamin D3 ointment (n = 36), methotrexate (n = 1), apremilast (n = 1), cyclosporine (n = 1), excimer 308-nm light treatment (n = 3), and no treatment (n = 9). These treatments were not successful, and thus, some of the patients were also treated with a biologic or underwent a tonsillectomy at our hospital. We evaluated PPPASI in all patients before treatment with biologics or tonsillectomy. Written informed consent to participate was obtained from all patients in accord with the Declaration of Helsinki. All of the protocols were approved by the institutional review boards of Sapporo Medical University Hospital (#25-39, #322-18).

      CSE preparation

      CSE was prepared as described previously (
      • Glader P.
      • Möller S.
      • Lilja J.
      • Wieslander E.
      • Löfdahl C.G.
      • von Wachenfeldt K.
      Cigarette smoke extract modulates respiratory defence mechanisms through effects on T-cells and airway epithelial cells.
      ;
      • Lee K.H.
      • Lee C.H.
      • Woo J.
      • Jeong J.
      • Jang A.H.
      • Yoo C.G.
      Cigarette smoke extract enhances IL-17A-induced IL-8 production via up-regulation of IL-17R in human bronchial epithelial cells.
      ). First, 30 ml of smoke from a filterless hi-light Japanese cigarette was collected by a syringe pump and vigorously bubbled through 5 ml of PBS for 30 seconds. CSE was then filtered through a 0.22-μm sterile filter (Corning, Corning, NY). CSE was aliquoted and stored at −80 °C until it was used for the treatment of cultured cells. CSE was used immediately in every experiment to avoid the breakdown of substances in the extract and the evaporation of volatile components.

      Cell culture and treatments

      Primary human tonsillar epithelial cells, human nasal epithelial cells, and human epidermal keratinocytes were derived from surgically resected palatine tonsils, nasal mucosa, and skin in neck areas, respectively. The cells were cultured as described previously (
      • Kamekura R.
      • Kojima T.
      • Koizumi J.
      • Ogasawara N.
      • Kurose M.
      • Go M.
      • et al.
      Thymic stromal lymphopoietin enhances tight-junction barrier function of human nasal epithelial cells.
      ). In this experiment, first-passaged cells were used. LY294002 (an inhibitor of phosphatidylinositol 3-kinase), PD98059 (an inhibitor of MAPK kinase), and SB203580 (an inhibitor of p38 MAPK) were obtained from Merck (Darmstadt, Germany). Recombinant human IL-17A (317-ILB-050) and an isotype control antibody were purchased from R&D Systems (Minneapolis, MN). Nicotine was obtained from Fujifilm Wako Pure Chemical Corp. (Osaka, Japan).

      Quantitative real-time PCR

      Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA) in accord with the manufacturer's protocol. The RT-PCR was performed with the use of MultiScribe reverse transcriptase (Thermo Fisher Scientific) per the manufacturer's protocol. A real-time PCR was performed using a LightCycler 96 (Hoffmann-La Roche, Basel, Switzerland) and a SYBER Premix Dimer Eraser (Takara Bio, Shiga, Japan). All primer sequences are shown in Supplementary Table S3. The levels of target mRNAs were normalized to GAPDH, and the relative expression of the transcripts was calculated using the ΔΔCT method relative to unstimulated samples.

      ELISA

      Blood samples were collected from the patients with PPP at the stage of preoperated active disease and from healthy donors as controls. Whole blood samples were centrifuged at 1,100g for 15 minutes at 4 °C and then aliquoted and stored at −80 °C until analysis. The concentrations of serum IL-36α and IL-36γ were analyzed in triplicate with ELISAs as described by the manufacturer (R&D Systems). The detection limits of IL-36α and IL-36γ are 12.5 and 18.75 pg/ml, respectively.

      Immunohistochemistry

      After tonsillectomy, resected tonsil specimens were fixed in 10% buffered formalin and embedded in paraffin blocks. Next, 4-μm-thick sections were prepared for immunohistochemistry. All sections were dewaxed, rehydrated, subjected to blocking and antigen retrieval, and then treated with goat anti-human IL-36α/1F6 (5 μg/ml, R&D Systems) and goat anti-human IL-36γ/1F9 (5 μg/ml, R&D Systems) antibodies in accord with the manufacturer's protocol. All immunohistochemistry sections were evaluated by three independent investigators blinded to the groups. We defined a brief assessment tool, the IL-36 immunostaining index, as the staining intensity score multiplied by the stained area score (Supplementary Table S4). The stained area of IL-36 in the tonsil epidermis was evaluated using a semiquantitative grading system: grade 0 = no staining, grade 1 = 1–25%, grade 2 = 26–50%, grade 3 = 51–75%, and grade 4 = 76–100%. The staining intensity of IL-36 was also evaluated: 0 = no staining, 1 = weak staining, 2 = moderate staining, and 3 = strong staining. The final index for each section was the mean of the three investigators' scores. The characteristics of the patients who took part in this examination are summarized in Supplementary Table S5.

      Statistical analyses

      All experiments were repeated at least three times, and the mean ± SD values were determined. Data were analyzed with a two-tailed Mann-Whitney U-test for comparisons of two groups. For comparisons of more than two groups, the Kruskal-Wallis test was used. We used the Wilcoxon signed-rank test to analyze the changes in the mRNA levels of IL17R. Correlation analyses were performed by calculating Spearman's rho. Prism 7 software (Graph Pad Software, La Jolla, CA) was used for all statistical analyses. Values of P < 0.05 were considered significant.

      Data availability statement

      No datasets were generated or analyzed during the current study.

      Conflict of Interest

      The authors state no conflict of interest.

      Acknowledgments

      This work was supported by grants-in-aid for scientific research from the Japanese Society for the Promotion of Science including grants #18K09323 (to RK), #19K08779 (JK), #18K09324 (KT), and #18H02632 (SI); the Takeda Science Foundation (RK); and the Bristrol-Myers Squibb (SI).

      Author Contributions

      Conceptualization: KK, RK; Data Curation: KK; Formal Analysis: KK; Funding Acquisition: RK, KT, SI; Investigation: KK, RK; Methodology: KK, RK, JK, SK, TK; Project Administration: RK; Resources: RK, SI; Supervision: KT, SI, HU; Validation: KK; Visualization: KK; Writing - Original Draft Preparation: KK, RK; Writing - Review and Editing: KK, RK, JK, SK, TK, KT, SI, HU

      Supplementary Material

      Figure thumbnail fx1
      Supplementary Figure S1IL-17A synergistically upregulated IL-36 expression in the presence of CSE in human nasal epithelial cells. Results of the quantitative RT-PCR to determine the IL36 family members, IL36RN, and IL8 mRNA levels. Epithelial cells were treated with 0.5% CSE in the presence or absence of IL-17A (30 ng/ml) for 24 hours. One representative result from three independent experiments is shown Data are mean ± SD (n = 3). ∗P < 0.05. CSE, cigarette smoke extract.
      Figure thumbnail fx2
      Supplementary Figure S2IL-17A synergistically upregulated IL-36 expression in the presence of CSE in human epidermal keratinocytes. Results of the quantitative RT-PCR to determine the IL36 family members, IL36RN, and IL8 mRNA levels. Epithelial cells were treated with 1% CSE in the presence or absence of IL-17A (100 ng/ml) for 24 hours. One representative result from three independent experiments is shown. Data are mean ± SD (n = 3). ∗P < 0.05 versus control. CSE, cigarette smoke extract.
      Figure thumbnail fx3
      Supplementary Figure S3The mRNA expressions of IL17R, IL36 family members, IL36RN, IL17A, and IL8 derived from primary cultures in patients with PPP were not upregulated compared with those of the non-PPP patients. Results of the quantitative RT-PCR to determine the IL17R, IL36 family members, IL36RN, IL17A, and IL8 mRNA levels for patients with various medical backgrounds (i.e., infantile OSAS, smoking history, and PPP). Error bars: mean ± SD for each medical background. OSAS, obstructive sleep apnea syndrome; PPP, palmoplantar pustulosis.
      Supplementary Table S1The Male-to-Female Smoking Ratios in Different Prefectures of Japan
      ReporterYearPrefectureThe Male-to-Female Ratio
      Kobayashi (our study)2020Hokkaido (Sapporo)44:140 = 1:3.18
      Hiraiwa2018Fukushima44:92 = 1:2.09
      Akiyama1995Gifu203:266 = 1:1.31
      Kubota2015All of Japan47,248:88,976 = 1:1.89
      Supplementary Table S2Adult (Male and Female) Smoking Prevalence By Prefecture (%)
      Perfecture
      SexYearHokkaidoFukushimaGifuAll of Japan
      Male200153.549.44848.4
      200449.947.545.844.9
      200743.942.839.139.7
      20103536.232.633.1
      201339.238.932.433.7
      201634.634.430.431.1
      Female200124.312.610.714
      200422.212.811.113.5
      200720.612.29.612.7
      201016.210.57.510.4
      201317.812.19.710.7
      201616.110.769.5
      Adult (male and female) smoking prevalences (%) for each 3-year period since 2001 for Hokkaido, Fukushima, and Gifu prefectures and the entire nation extracted from the Cancer Information Service, National Cancer Center, Japan.
      Supplementary Table S3Primers Used in the Quantitative RT-PCR Experiments
      Human GeneDirectionSequence 5′➝3′
      IL17RAForwardAGACACTCCAGAACCAATTCC
      ReverseTCTTAGAGTTGCTCTCCACCA
      IL17RCForwardACCAGAACCTCTGGCAAGC
      ReverseGAGCTGTTCACCTGAACACA
      IL17REForwardCTGCTGTCAGGTGGCTCA
      ReverseGGAAGACTTTTTGGATTTCTGC
      IL36AForwardTTGCCTTAATCTCATGCCGAC
      ReverseCCGACTTTAGCACACATCAGG
      IL36BForwardAGAAATTCAGGGCAAGCCTAC
      ReverseCAGCCAGGGTAAGAGACTGAC
      IL36GForwardGAAACCCTTCCTTTTCTACCGTG
      ReverseGCTGGTCTCTCTTGGAGGAG
      IL36RNForwardACTCGGCATTGAAGGTGCTTT
      ReverseGGGACCACGCTGATCTCTT
      IL8ForwardGTGCAGTTTTGCCAAGGAGT
      ReverseCTCTGCACCCAGTTTTCCTT
      IL17AForwardCATCCATAACCGGAATACCAATA
      ReverseTAGTCCACGTTCCCATCAGC
      GAPDHForwardGAGTCAACGGATTTGGTCGT
      ReverseTTGATTTTGGAGGGATCTCG
      Supplementary Table S4Definition and Calculation of the IL-36 Immunostaining Index in Human Tonsil Epithelial Cells
      Score (P)01234
      Staining IntensityNoneWeakModerateStrong
      Stained area (%)01 < 2526 < 5051 < 7576 < 100
      Abbreviation: P, stained area score.
      IL-36 immunostaining index = P × Q.
      Supplementary Table S5Characteristics of Patients with PPP and Non-PPP Patients in the IL-36 Immunostaining Examination
      CharacteristicsPPP (n = 12), n (%)Non-PPP
      Patients with recurrent tonsillitis who underwent tonsillectomy.
      (n = 9), n (%)
      Sex
       Female10 (83.3%)7 (77.8%)
       Male2 (16.7%)2 (22.2%)
      Age (y), mean ± SD51.8 ± 15.028.9 ± 7.7
      Smoking habit
       Never smoker
      Has never smoked in the past and is not regularly exposed to second-hand smoke.
      0N/A
       Second-hand-smoker4 (33.3%)N/A
       Current or past smoker8 (67.7%)N/A
      Smoking Index, mean ± SD490.0 ± 485.1N/A
      PPPASI, mean ± SD13.8 ± 9.1N/A
      Range3.9–34.8N/A
      Low score group (range)6 (3.9–10.2)N/A
      High score group (range)6 (11.2–34.8)N/A
      Abbreviations: N/A, not applicable; PPP, palmoplantar pustulosis; PPPASI, Palmoplantar Pustulosis Area and Severity Index.
      1 Patients with recurrent tonsillitis who underwent tonsillectomy.
      2 Has never smoked in the past and is not regularly exposed to second-hand smoke.

      References

        • Akiyama T.
        • Seishima M.
        • Watanabe H.
        • Nakatani A.
        • Mori S.
        • Kitajima Y.
        The relationships of onset and exacerbation of pustulosis palmaris et plantaris to smoking and focal infections.
        J Dermatol. 1995; 22: 930-934
        • Andrews G.C.
        • Machacek G.F.
        Pustular bacterids of the hands and feet.
        Arch Derm Syphilol. 1935; 32: 837-847
        • Arakawa A.
        • Vollmer S.
        • Besgen P.
        • Galinski A.
        • Summer B.
        • Kawakami Y.
        • et al.
        Unopposed IL-36 activity promotes clonal CD4+ T-cell responses with IL-17A production in generalized pustular psoriasis.
        J Invest Dermatol. 2018; 138: 1338-1347
        • Aurrekoetxea J.J.
        • Murcia M.
        • Rebagliato M.
        • Fernández-Somoano A.
        • Castilla A.M.
        • Guxens M.
        • et al.
        Factors associated with second-hand smoke exposure in non-smoking pregnant women in Spain: self-reported exposure and urinary cotinine levels.
        Sci Total Environ. 2014; 470–471: 1189-1196
        • Bhushan M.
        • Burden A.D.
        • McElhone K.
        • James R.
        • Vanhoutte F.P.
        • Griffiths C.E.
        Oral liarozole in the treatment of palmoplantar pustular psoriasis: a randomized, double-blind, placebo-controlled study.
        Br J Dermatol. 2001; 145: 546-553
        • Bissonnette R.
        • Fuentes-Duculan J.
        • Mashiko S.
        • Li X.
        • Bonifacio K.M.
        • Cueto I.
        • et al.
        Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway.
        J Dermatol Sci. 2017; 85: 20-26
        • Carrier Y.
        • Ma H.L.
        • Ramon H.E.
        • Napierata L.
        • Small C.
        • O'Toole M.
        • et al.
        Inter-regulation of Th17 cytokines and the IL-36 cytokines in vitro and in vivo: implications in psoriasis pathogenesis.
        J Invest Dermatol. 2011; 131: 2428-2437
        • D'Erme A.M.
        • Wilsmann-Theis D.
        • Wagenpfeil J.
        • Hölzel M.
        • Ferring-Schmitt S.
        • Sternberg S.
        • et al.
        IL-36γ (IL-1F9) is a biomarker for psoriasis skin lesions.
        J Invest Dermatol. 2015; 135: 1025-1032
        • Glader P.
        • Möller S.
        • Lilja J.
        • Wieslander E.
        • Löfdahl C.G.
        • von Wachenfeldt K.
        Cigarette smoke extract modulates respiratory defence mechanisms through effects on T-cells and airway epithelial cells.
        Respir Med. 2006; 100: 818-827
        • Gunes S.
        • Metin Mahmutoglu A.
        • Arslan M.A.
        • Henkel R.
        Smoking-induced genetic and epigenetic alterations in infertile men.
        Andrologia. 2018; 50: e13124
        • Harabuchi Y.
        • Takahara M.
        Pathogenic role of palatine tonsils in palmoplantar pustulosis: a review.
        J Dermatol. 2019; 46: 931-939
        • Henry C.M.
        • Sullivan G.P.
        • Clancy D.M.
        • Afonina I.S.
        • Kulms D.
        • Martin S.J.
        Neutrophil-derived proteases escalate inflammation through activation of IL-36 family cytokines.
        Cell Rep. 2016; 14: 708-722
        • Hiraiwa T.
        • Yamamoto T.
        Comorbidities of Japanese patients with palmoplantar pustulosis: a report from a single center.
        Int J Dermatol. 2018; 57: e40-e41
        • Hot A.
        • Zrioual S.
        • Toh M.L.
        • Lenief V.
        • Miossec P.
        IL-17A- versus IL-17F-induced intracellular signal transduction pathways and modulation by IL-17RA and IL-17RC RNA interference in rheumatoid synoviocytes.
        Ann Rheum Dis. 2011; 70: 341-348
        • Johnston A.
        • Xing X.
        • Wolterink L.
        • Barnes D.H.
        • Yin Z.
        • Reingold L.
        • et al.
        IL-1 and IL-36 are dominant cytokines in generalized pustular psoriasis.
        J Allergy Clin Immunol. 2017; 140: 109-120
        • Kamekura R.
        • Kojima T.
        • Koizumi J.
        • Ogasawara N.
        • Kurose M.
        • Go M.
        • et al.
        Thymic stromal lymphopoietin enhances tight-junction barrier function of human nasal epithelial cells.
        Cell Tissue Res. 2009; 338: 283-293
        • Klein S.L.
        • Flanagan K.L.
        Sex differences in immune responses.
        Nat Rev Immunol. 2016; 16: 626-638
        • Kouno M.
        • Nishiyama A.
        • Minabe M.
        • Iguchi N.
        • Ukichi K.
        • Nomura T.
        • et al.
        Retrospective analysis of the clinical response of palmoplantar pustulosis after dental infection control and dental metal removal.
        J Dermatol. 2017; 44: 695-698
        • Kubota K.
        • Kamijima Y.
        • Sato T.
        • Ooba N.
        • Koide D.
        • Iizuka H.
        • et al.
        Epidemiology of psoriasis and palmoplantar pustulosis: a nationwide study using the Japanese national claims database.
        BMJ Open. 2015; 5e006450
        • Kum-Nji P.
        • Meloy L.
        • Keyser-Marcus L.
        Tobacco smoke exposure as a risk factor for human papillomavirus infections in women 18–26 years old in the United States.
        PLoS One. 2019; 14e0223532
        • Lee K.H.
        • Lee C.H.
        • Woo J.
        • Jeong J.
        • Jang A.H.
        • Yoo C.G.
        Cigarette smoke extract enhances IL-17A-induced IL-8 production via up-regulation of IL-17R in human bronchial epithelial cells.
        Mol Cells. 2018; 41: 282-289
        • Li N.
        • Yamasaki K.
        • Saito R.
        • Fukushi-Takahashi S.
        • Shimada-Omori R.
        • Asano M.
        • et al.
        Alarmin function of cathelicidin antimicrobial peptide LL37 through IL-36γ induction in human epidermal keratinocytes.
        J Immunol. 2014; 193: 5140-5148
        • Liang Y.
        • Xing X.
        • Beamer M.A.
        • Swindell W.R.
        • Sarkar M.K.
        • Roberts L.W.
        • et al.
        Six-transmembrane epithelial antigens of the prostate comprise a novel inflammatory nexus in patients with pustular skin disorders.
        J Allergy Clin Immunol. 2017; 139: 1217-1227
        • Mallampalli R.K.
        • Li X.
        • Jang J.H.
        • Kaminski T.
        • Hoji A.
        • Coon T.
        • et al.
        Cigarette smoke exposure enhances transforming acidic coiled-coil-containing protein 2 turnover and thereby promotes emphysema.
        JCI Insight. 2020; 5e125895
        • Meier-Schiesser B.
        • Feldmeyer L.
        • Jankovic D.
        • Mellett M.
        • Satoh T.K.
        • Yerly D.
        • et al.
        Culprit drugs induce specific IL-36 overexpression in acute generalized exanthematous pustulosis.
        J Invest Dermatol. 2019; 139: 848-858
        • Michaëlsson G.
        • Gustafsson K.
        • Hagforsen E.
        The psoriasis variant palmoplantar pustulosis can be improved after cessation of smoking.
        J Am Acad Dermatol. 2006; 54: 737-738
        • Miot H.A.
        • Miot L.D.
        • Lopes P.S.
        • Haddad G.R.
        • Marques S.A.
        Association between palmoplantar pustulosis and cigarette smoking in Brazil: a case-control study.
        J Eur Acad Dermatol Venereol. 2009; 23: 1173-1177
        • Misiak-Galazka M.
        • Zozula J.
        • Rudnicka L.
        Palmoplantar pustulosis: recent advances in etiopathogenesis and emerging treatments.
        Am J Clin Dermatol. 2020; 21: 355-370
        • Mrowietz U.
        • Bachelez H.
        • Burden A.D.
        • Rissler M.
        • Sieder C.
        • Orsenigo R.
        • et al.
        Secukinumab for moderate-to-severe palmoplantar pustular psoriasis: results of the 2PRECISE study.
        J Am Acad Dermatol. 2019; 80: 1344-1352
        • Mrowietz U.
        • van de Kerkhof P.C.
        Management of palmoplantar pustulosis: do we need to change?.
        Br J Dermatol. 2011; 164: 942-946
        • Murakami M.
        • Kameda K.
        • Tsumoto H.
        • Tsuda T.
        • Masuda K.
        • Utsunomiya R.
        • et al.
        TLN-58, an additional hCAP18 processing form, found in the lesion vesicle of palmoplantar pustulosis in the skin.
        J Invest Dermatol. 2017; 137: 322-331
        • Murakami M.
        • Ohtake T.
        • Horibe Y.
        • Ishida-Yamamoto A.
        • Morhenn V.B.
        • Gallo R.L.
        • et al.
        Acrosyringium is the main site of the vesicle/pustule formation in palmoplantar pustulosis.
        J Invest Dermatol. 2010; 130: 2010-2016
        • Ngo C.Q.
        • Phan P.T.
        • Vu G.V.
        • Chu H.T.
        • Nguyen T.T.
        • Nguyen M.H.
        • et al.
        Prevalence and sources of second-hand smoking exposure among non-smoking pregnant women in an urban setting of Vietnam.
        Int J Environ Res Public Health. 2019; 16: 5022
        • Pfaff C.M.
        • Marquardt Y.
        • Fietkau K.
        • Baron J.M.
        • Lüscher B.
        The psoriasis-associated IL-17A induces and cooperates with IL-36 cytokines to control keratinocyte differentiation and function.
        Sci Rep. 2017; 7: 15631
        • Rennard S.I.
        Cigarette smoke in research.
        Am J Respir Cell Mol Biol. 2004; 31: 479-480
        • Scherer H.U.
        • Häupl T.
        • Burmester G.R.
        The etiology of rheumatoid arthritis.
        J Autoimmun. 2020; 110: 102400
        • Sims J.E.
        • Smith D.E.
        The IL-1 family: regulators of immunity.
        Nat Rev Immunol. 2010; 10: 89-102
        • Takahara M.
        • Hirata Y.
        • Nagato T.
        • Kishibe K.
        • Katada A.
        • Hayashi T.
        • et al.
        Treatment outcome and prognostic factors of tonsillectomy for palmoplantar pustulosis and pustulotic arthro-osteitis: a retrospective subjective and objective quantitative analysis of 138 patients.
        J Dermatol. 2018; 45: 812-823
        • Talhout R.
        • Schulz T.
        • Florek E.
        • van Benthem J.
        • Wester P.
        • Opperhuizen A.
        Hazardous compounds in tobacco smoke.
        Int J Environ Res Public Health. 2011; 8: 613-628
        • Terui T.
        • Kobayashi S.
        • Okubo Y.
        • Murakami M.
        • Zheng R.
        • Morishima H.
        • et al.
        Efficacy and safety of guselkumab in Japanese patients with palmoplantar pustulosis: a phase 3 randomized clinical trial.
        JAMA Dermatol. 2019; 155: 1153-1161
        • Towne J.E.
        • Sims J.E.
        IL-36 in psoriasis.
        Curr Opin Pharmacol. 2012; 12: 486-490
        • Tsuji G.
        • Takahara M.
        • Uchi H.
        • Takeuchi S.
        • Mitoma C.
        • Moroi Y.
        • et al.
        An environmental contaminant, benzo(a)pyrene, induces oxidative stress-mediated interleukin-8 production in human keratinocytes via the aryl hydrocarbon receptor signaling pathway.
        J Dermatol Sci. 2011; 62: 42-49
        • Vardavas C.I.
        • Plada M.
        • Tzatzarakis M.
        • Marcos A.
        • Warnberg J.
        • Gomez-Martinez S.
        • et al.
        Passive smoking alters circulating naïve/memory lymphocyte T-cell subpopulations in children.
        Pediatr Allergy Immunol. 2010; 21: 1171-1178
        • Xiaoling Y.
        • Chao W.
        • Wenming W.
        • Feng L.
        • Hongzhong J.
        Interleukin (IL)-8 and IL-36γ but not IL-36Ra are related to acrosyringia in pustule formation associated with palmoplantar pustulosis.
        Clin Exp Dermatol. 2019; 44: 52-57
        • Yamamoto T.
        Clinical characteristics of Japanese patients with palmoplantar pustulosis.
        Clin Drug Investig. 2019; 39: 241-252
        • Zeng N.
        • Wang T.
        • Chen M.
        • Yuan Z.
        • Qin J.
        • Wu Y.
        • et al.
        Cigarette smoke extract alters genome-wide profiles of circular RNAs and mRNAs in primary human small airway epithelial cells.
        J Cell Mol Med. 2019; 23: 5532-5541