If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Institute of Pharmaceutical Sciences (IPW), Swiss Federal Institute of Technology (ETH Zurich), Zurich, SwitzerlandProgram in Epithelial Biology, Stanford University School of Medicine, Stanford, California, USA
7 These authors contributed equally as senior authors.
Carlotta Tacconi
Footnotes
7 These authors contributed equally as senior authors.
Affiliations
Institute of Pharmaceutical Sciences (IPW), Swiss Federal Institute of Technology (ETH Zurich), Zurich, SwitzerlandDepartment of Biosciences, University of Milan, Milano, Italy
7 These authors contributed equally as senior authors.
Michael Detmar
Correspondence
Correspondence: Michael Detmar, Institute of Pharmaceutical Sciences, Swiss Federal Institute of Technology (ETH Zurich), Vladimir-Prelog-Weg 3, HCI H303, Zürich CH-8093, Switzerland.
Psoriasis is a chronic inflammatory skin disease that often recurs at the same locations, indicating potential epigenetic changes in lesional skin cells. In this study, we discovered that fibroblasts isolated from psoriatic skin lesions retain an abnormal phenotype even after several passages in culture. Transcriptomic profiling revealed the upregulation of several genes, including the extra domain A splice variant of fibronectin and ITGA4 in psoriatic fibroblasts. A phenotypic library screening of small-molecule epigenetic modifier drugs revealed that selective CBP/p300 inhibitors were able to rescue the psoriatic fibroblast phenotype, reducing the expression levels of extra domain A splice variant of fibronectin and ITGA4. In the imiquimod-induced mouse model of psoriasis-like skin inflammation, systemic treatment with A485, a potent CBP/p300 blocker, significantly reduced skin inflammation, immune cell recruitment, and inflammatory cytokine production. Our findings indicate that epigenetic reprogramming might represent a new approach for the treatment and/or prevention of relapses of psoriasis.
Psoriasis is an immune-mediated chronic inflammatory skin disease characterized by hyperproliferation of epidermal keratinocytes; immune cell infiltration; remodeling of the dermal vasculature; and activation of fibroblasts, which secrete inflammatory cytokines and altered extracellular matrix (ECM) proteins. Up to 30% of patients with psoriasis also suffer from comorbidities such as psoriatic arthritis, metabolic syndrome, and cardiovascular disorders (
Fibroblasts represent the major type of stromal cells with a structural role through the synthesis of ECM proteins (e.g., fibronectin [FN], vimentin, and collagens) as well as the production of cytokines, chemokines, and GFs (
). Fibroblasts play a pivotal role in maintaining the homeostasis of adjacent cells and in coordinating inflammatory responses, rendering them indispensable for tissue development, differentiation, and repair. Under chronic inflammatory conditions, fibroblasts can become activated and manifest enhanced production of ECM proteins, including type I collagen, tenascin C, SPARC (secreted protein acidic and rich in cysteine), and de novo expression of the extra domain A FN (EDA FN) splice variant (
) but also nonlesional skin showed high expression levels of EDA FN, which was correlated with the degree of inflammation and also with epigenetic modifications, such as DNA methylation (
). These findings indicate that a potential epigenetic memory of skin cells might contribute to the relapse of psoriatic skin lesions.
Epigenetics describes heritable or reversible changes that can affect gene expression without any alteration in the DNA sequence. Epigenetic changes include alterations of the DNA accessibility by chromatin remodeling, DNA modification, or histone modification (
). Epigenetic changes are dynamically reversible, and several inhibitor drugs targeting DNA methyltransferases or histone deacetylases have been shown to restore normal epigenetic patterns in a number of diseases (
). Epigenetic writers, readers, and erasers that antagonize or inhibit specific domains of epigenetic protein complexes have been previously used for drug screenings in cancers (
). However, despite several epigenetic studies demonstrating the involvement of DNA methylation, histone modification, and noncoding RNA regulation in the pathogenesis of psoriasis (
), no comprehensive epigenetic drug screening has been performed in psoriasis.
We aimed to establish and apply assays for epigenetic drug screens in cultured fibroblasts derived from psoriatic plaques. We chose fibroblasts because they represent a major population of dermal cells and their contributions to psoriasis pathogenesis have been indicated in several studies (
). In particular, previous studies have shown that cultured fibroblasts from psoriatic skin lesions maintain phenotypic differences over several passages in vitro (
). In line with this, we also found that psoriatic fibroblasts maintained increased expression of several genes, including EDA FN and ITGA4, even after several passages in vitro. An epigenetic drug screen using 48 small molecules revealed that treatment with selective p300/CBP inhibitors reduced the expression of these genes. In a mouse model of psoriasis-like skin inflammation, systemic treatment with the specific p300/CBP histone acetyltransferase (HAT) domain inhibitor, A485, strongly reduced imiquimod (IMQ)-induced skin inflammation. These findings might have potential implications for future strategies to treat and/or prevent the relapse of psoriatic skin lesions.
Results
Distinct transcriptomic profiles of fibroblasts derived from psoriatic skin
Fibroblasts derived from psoriatic lesions were reported to retain an activated phenotype (
). We isolated psoriatic and healthy dermal fibroblasts from chronic psoriatic plaques and healthy skin from patients admitted to plastic surgery, respectively. We developed a standardized workflow for isolating fibroblasts (Figure 1a). The skin tissue was mechanically and enzymatically digested after removing the epidermal layer. Fibroblasts from the dermis were isolated after negative selection with CD31 Dynabeads and showed the expression of PDGFRa, considered a fibroblast marker (Figure 1b and c).
Figure 1RNA sequencing of fibroblasts from psoriatic and healthy skin. (a) Overview of the experimental workflow of the study. (b, c) Total RNA was extracted from healthy (n = 6) and psoriatic (n = 3) fibroblasts and subjected to RNA-Seq. Gene expression (TPM) of (b) CD90 and (c) PDGFRa in healthy (n = 6) and psoriatic fibroblasts (n = 3). (d) Representative flow cytometry histograms of PDGFRa protein levels in healthy (blue) and psoriatic (red) fibroblasts. DFs (green) and FMO (gray) control were used as positive control and negative control, respectively, and quantification (MFI) of PDGFRa was expressed as FC over healthy fibroblasts. (e) PCA from RNA-Seq showing a distinct transcriptomic landscape of healthy and psoriatic fibroblasts. (f) Heatmap showing differential gene expression between healthy and psoriatic fibroblasts (log2 FC ≥ 0.6 and P < 0.05). (g) GO analysis of biological processes using PANTHER for the top 10 upregulated terms in psoriatic fibroblasts expressed as ‒Log10(P-value). ∗P < 0.05 and ∗∗∗P < 0.001. (h) ITGA4 and (i) EDA FN expression levels evaluated by qPCR (n = 2 lines per group in 2‒3 biological replicates). Data represent mean ± SD. Significance was determined by unpaired Student’s t-test. ∗∗∗∗P < 0.0001. (j) GSEA showing that genes downregulated in psoriatic fibroblasts were enriched for chromatin silencing, gene expression epigenetics, and histone exchange. Running ES score and positions of gene set members on the rank-ordered list (NES) based on the significance value from GSEA. The GSEA results are listed in Supplementary Table S3. DF, dermal fibroblast; EDA FN, extra domain A of fibronectin; ES, enrichment score; FC, fold change; FMO, fluorescence minus one; GO, gene ontology; GSEA, gene set enrichment analysis; MFI, mean fluorescent intensity; NES, normalized enrichment score; PC, principal component; PCA, principal component analysis; RNA-Seq, RNA sequencing; TPM, transcript per million.
RNA sequencing was performed in six healthy and three psoriatic fibroblast lines at passages 2‒4 (Supplementary Table S1). Robust expression of the fibroblast-related markers CD90 and PDGFRa but not of keratinocyte (CD49f) or endothelial cell (EC) (CD31) markers confirmed the purity of the samples that were used for sequencing (Figure 1b‒d and Supplementary Figure S1a). Principal component analysis showed that the samples clustered according to healthy and psoriatic fibroblasts (Figure 1e). Differential gene expression analysis, using a log2 fold change ≥ 0.6 and a P < 0.05 as a threshold, revealed major changes at the transcriptional level, with 637 genes being upregulated and 657 genes being downregulated in psoriatic fibroblasts (Figure 1f). Gene ontology analysis using PANTHER highlighted the integrin signaling pathway as the most enriched biological process in psoriatic fibroblasts (Figure 1g and Supplementary Table S2). Interestingly, among the other enriched terms (P < 0.05), there was angiogenesis related to vascular expansion, both found by PANTHER and in gene ontology biological processes, which is a characteristic feature of psoriatic skin lesions (
), indicating a potential contribution of psoriatic fibroblasts to EC activation (Supplementary Figure S1b).
Remarkably, we found that ITGA4 was significantly increased in psoriatic fibroblasts (log2 fold change = 1.2) (Figure 1f). This was confirmed by qPCR, which showed an upregulation of ITGA4 expression (fold change = 5.3, P < 0.0001) in psoriatic fibroblasts (Figure 1h). ITGA4 pairs exclusively with ITGB1 and ITGB7 to bind to FN (
). Interestingly, ECM‒receptor interaction was identified by Kyoto Encyclopedia of Genes and Genomes as the most enriched gene ontology term in psoriatic fibroblasts, confirming the important role of psoriatic fibroblasts in ECM molecule production (Supplementary Figure S1b). The EDA FN is an alternatively spliced form of FN expressed in cancer and chronic inflammation but absent under physiological conditions (
A high-affinity human monoclonal antibody specific to the alternatively spliced EDA domain of fibronectin efficiently targets tumor neo-vasculature in vivo.
). We analyzed the expression of EDA FN by qPCR and found a significant upregulation (fold change = 2.4, P < 0.0001) in psoriatic fibroblasts (Figure 1i).
These results reveal that fibroblasts isolated from psoriatic skin possess a distinct gene expression profile, which is maintained on at least four passages in culture.
Screening of a library of small molecular epigenetic modifier drugs identifies the CBP/p300 inhibitor A485 as a repressor of ITGA4 and EDA FN expression
Gene set enrichment analysis of the transcriptional profiles pinpointed terms related to chromatin silencing (normalized enrichment score = ‒2.48, P < 0.0001), negative regulation of gene expression in epigenetic (normalized enrichment score = 2.42, P < 0.0001), and histone exchange (normalized enrichment score = 2.37, P < 0.0001) in psoriatic fibroblasts (Figure 1j and Supplementary Figure S2a and b and Supplementary Table S3). This suggests that psoriatic fibroblasts can maintain their transcriptional aberrations at least partially through epigenetic modifications. We next screened a library of 48 small-molecule epigenetic modifier drugs for their ability to reduce ITGA4 and EDA FN expression in psoriatic fibroblasts from two different donors (Figure 2a). As shown in Figure 2b and c, (+)-JQ1, an inhibitor of the bromodomain (BRD) and extraterminal domain family (
Figure 2Screening of 48 small-molecule epigenetic modifiers for their potential to downregulate the expression of ITGA4 and EDA FN in psoriatic fibroblasts. (a) Schematic workflow showing the experimental design used for the epigenetic drug screening. An epigenetic drug library was screened in psoriatic fibroblasts (n = 2 lines in duplicates) for either 3 or 7 days depending on the drug used (Supplementary Table S4). After the treatment, cells were analyzed by qPCR for ITGA4 and EDA FN expression changes. (b, c) The variation of the expression of (b) ITGA4 and (c) EDA FN under 48 small-molecule epigenetic modifier drugs in psoriatic fibroblasts was quantified by qPCR (n = 2 lines in duplicates per treatment group). Gene expression was normalized to GAPDH using the 2-ΔCT method and expressed as fold changes to the DMSO vehicle control. Red bars indicate the most efficient and consistent (relative value < 0.5) epigenetic modifier drugs selected for further studies. (d) MUH cell viability assay was performed with the indicated treatment for 72 hours (n = 2 lines with ≥ 6 replicates per group), expressed as fold changes to the DMSO vehicle control. (e) MUH cell viability assay after treatment with SGC-CBP30, I-CBP112, and A485 in both psoriatic and healthy fibroblasts (n = 2 lines each in ≥ 6 replicates per treatment group). (f) Schematic illustration of the action of I-CBP112, SGC-CBP30, and A485 epigenetic modifier compounds on blocking the CBP/p300 BRD or the HAT domain. (g) ITGA4 and (h) EDA FN expression in psoriatic and healthy fibroblasts (n = 1 line each in triplicates per group) under the treatments of I-CBP112, SGC-CBP30, A485, or DMSO vehicle control. Gene expression was normalized to GAPDH and shown with the 2-ΔCT method. (i) Western blot images and quantification of ITGA4 protein levels in psoriatic and healthy fibroblasts treated with I-CBP112, A485, or DMSO control (n = 2 lines each per group in three independent experiments). ß-Actin served as the loading control. Values are shown as a ratio normalized to the DMSO vehicle control. (j) Representative images of western blot for EDA FN protein levels in psoriatic and healthy fibroblasts treated with I-CBP112, A485, or DMSO control (n = 2 lines each per group in three independent experiments) and their quantifications. (k) Western blot image and analysis of H3K27ac levels in vehicle- or A485-treated psoriatic and healthy fibroblasts. Total histone H3 served as the loading control (n = 2 lines each in triplicates per treatment group). All data represent mean ± SD. Significance was determined by unpaired or paired (western blots of vehicle treatment for i‒k) Student’s t-test (ns P > 0.05). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, and ∗∗∗∗P < 0.0001. BRD, bromodomain; EDA FN, extra domain A of fibronectin; H3K27ac, acetylation of lysine 27 on histone 3; HAT, histone acetyltransferase; IC90, the 90% maximal inhibitory concentration; ns, not significant.
We next tested the effects of (+)-JQ1, A485, I-CBP 112, and SGC-CBP30 on fibroblast proliferation using the MUH cell viability assay. (+)-JQ1 treatment resulted in significant inhibition of psoriatic fibroblast proliferation and was therefore excluded from further experiments (Figure 2d). By contrast, A485, I-CBP 112, and SGC-CBP30 did not inhibit fibroblast proliferation (Figure 2e). Interestingly, I-CBP 112, SGC-CBP30, and A485 target the activity of the same protein, namely CBP/p300. CBP/p300 is a transcriptional coactivator that can acetylate several lysine sites, for instance, on histone H3K27 (
). As shown in Figure 2f, p300 and CBP contain a BRD and a HAT domain that can be selectively inhibited by the small molecules I-CBP 112, SGC-CBP30, and A485.
We next compared the effects of I-CBP 112, SGC-CBP30, and A485 on ITGA4 and EDA FN expression in both psoriatic and healthy fibroblasts in more detail. As shown in Figure 2g and h, the expression levels of ITGA4 and EDA FN were higher in psoriatic fibroblasts than in healthy fibroblasts, consistent with the results of transcriptomic profiling (Figure 1f, h, and i). Treatment with all three drugs significantly reduced EDA FN expression in healthy fibroblasts, and A485 and I-CBP 112 reduced its expression in psoriatic fibroblasts. Only A485 treatment reduced ITGA4 transcriptional expression levels. Although A485 and I-CBP112 treatment exhibited no significant effects on ITGA4 protein levels overall (Figure 2i), A485 significantly reduced EDA FN protein levels in both psoriatic and healthy fibroblasts, whereas the effects of I-CBP112 were less pronounced (Figure 2j). Given the significantly higher level of acetylation of lysine 27 on histone 3 (H3K27ac) in psoriatic compared with that in healthy fibroblasts, we next studied the effects of A485 on H3K27ac levels. Treatment with A485 strongly diminished total H3K27ac levels in psoriatic fibroblasts, with only minor effects on healthy fibroblasts (Figure 2k). To assess the occupancy of p300/CBP and H3K27ac at the gene regions of FN1 and ITGA4 in fibroblasts, we performed sequential chromatin immunoprecipitation followed by qPCR. The occupancy of p300/CBP and H3K27ac was significantly reduced on A485 treatment compared with that of vehicle control (Supplementary Figure S2c and d). In addition, another inhibitor of the CBP/p300 HAT domain, iP300w, inhibited the expression levels of EDA FN and ITGA4 significantly in the same manner as A485 (Supplementary Figure S2e and f), validating the effect of H3K27ac on the expression of EDA FN and ITGA4. It is of interest that we found that the H3K27ac expression in psoriatic skin was significantly higher than in healthy skin tissue, especially in the dermis, confirming increased levels of H3K27 acetylation in the skin of patients with psoriasis (Supplementary Figure S3a and b).
The specific CBP/p300 HAT inhibitor A485 alleviates IMQ-induced skin inflammation and decreases relative EDA Fn expression in vivo
To study the potential therapeutic efficacy of A485 in a mouse model of psoriasis-like skin inflammation, we topically applied 5% IMQ cream on mouse ear skin and administered it daily with intraperitoneal injections of DMSO vehicle or A485 for 7 consecutive days (Figure 3a). Because A485 selectively inhibits the HAT domain of CBP/p300, which is responsible for the H3K27ac, we first evaluated the levels of H3K27ac in inflamed ear tissue after the treatment. A485 treatment efficiently reduced CBP/p300 HAT activity as shown by lower levels of H3K27ac over total H3 in the inflamed ear tissue of A485-treated mice (Figure 3b).
Figure 3The p300/CBP HAT inhibitor A485 reduces psoriasis-like skin inflammation. (a) Schematic of the treatment schedule with IMQ to induce psoriasis-like inflammation in mouse ear skin. Mice were treated once per day with A485 or DMSO vehicle control (vehicle) by intraperitoneal injections and euthanized on day 7. (b) Western blot image and analysis of H3K27ac protein levels in inflamed ear tissue lysates from vehicle- or A485-treated mice. Total histone H3 served as the loading control (n = 3 mice per group). (c) Ear thickness expressed as a change compared with ear thickness before IMQ challenge (n = 6–8 mice per group). (d) PASI score resulting from the visual evaluation of ear skin redness, scaling, and ear thickness (n = 6–8 mice per group). (e) The weights of auricular draining LNs on day 7 after the first IMQ application (n = 6‒8 mice per group). (f) Representative images of H&E-stained ear skin sections and quantification of the epidermal thickness (n = 6‒8 mice per group). Bars = 200 μm. (g) Representative immunofluorescence images of inflamed ears of mice that received DMSO vehicle or A485, stained for K6 (green) and Hoechst (blue) and their quantification (n = 6‒8 mice per group). Values were normalized to BM length. Bars = 50 μm. (h) Representative immunofluorescence images of inflamed ears of mice that received DMSO vehicle or A485-stained for Ki-67 (red) and Hoechst (blue) and their quantification (n = 6‒8 mice per group). Values were normalized by field. Bars = 50 μm. (i‒l) The gene expression level of (i) EDA Fn, (j) Fn1, (k) normalized EDA Fn, and (l) Itga4 in inflamed ear tissues under vehicle or A485 treatment. mRNA levels of EDA Fn were normalized on total fibronectin in k, whereas (i) EDA Fn, (j) Fn1, and Itga4 (l) were normalized to Gapdh (n = 6‒8 mice per group). All data represent mean ± SD. Significance was determined by two-way ANOVA test with Sidak’s correction for multiple comparisons in c and d or by unpaired Student’s t-test for b and e‒l. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, and ∗∗∗∗P < 0.0001. BM, basement membrane; EDA Fn, extra domain A of fibronectin; Fn, fibronectin; H3K27ac, acetylation of lysine 27 on histone 3; HAT, histone acetyltransferase; IMQ, imiquimod; i.p., intraperitoneal; K6, keratin 6; LN, lymph node.
The ear thickness and PASI score, a combined evaluation of redness, scaling, and tissue swelling, were significantly reduced after A485 treatment (Figure 3c and d). In line with reduced inflammation, the weight of the draining auricular lymph nodes was significantly lighter in A485-treated mice (Figure 3e). Mice under A485 treatment showed a moderate 8% body weight loss compared with control mice after 7 days of treatment (Supplementary Figure S4a) without any other obvious adverse effects, which is in agreement with the findings of a previous study (
) in tumor-bearing mice, which showed that A485 induced a moderate 9% body weight loss and that the mice recovered rapidly on completion of the A485 treatment. Histological analysis of IMQ-treated ears showed a significant reduction in epidermal thickness after A485 treatment (Figure 3f). Immunostainings for the proliferation-associated keratin 6 revealed a significantly reduced keratin 6‒positive area in the epidermis of A485-treated mice (Figure 3g). In agreement, also the number of Ki-67‒positive proliferating epidermal keratinocytes was significantly reduced (Figure 3h). No major differences in lymphatic and blood vessel numbers or the relative area covered by these vessels were found in the ears of A485-treated and control mice (Supplementary Figure S5a‒e). We found no major changes in overall EDA Fn or Fn1 expression levels (Figure 3i and j) but a significant reduction in the expression of EDA Fn normalized to total Fn1 (Figure 3k) in the ear skin of A485-treated mice, whereas Itga4 expression was slightly reduced (Figure 3l). When we normalized the EDA Fn and Itga4 mRNA expression to the expression of the fibroblast markers vimentin and Pdgfra, since fibroblasts are only one of the cell types in human skin, and since the qPCR was done with RNA extracted from whole skin samples, we found a down-regulation of Fn1, EDA Fn, and Itga4 expression by A485 in vivo although the results did not reach statistical significance (Supplementary Figure S4d). These findings indicate that A485, by inhibiting the acetylation of H3K27, can normalize the expression of EDA FN, an important ECM protein elevated in chronic inflammatory conditions (
We next investigated the effects of A485 treatment on different immune cell populations. Ears of A485-treated or vehicle control‒treated mice were collected on day 7 after IMQ challenge and processed for flow cytometry. Live cells were gated for CD45 positivity, and each subpopulation of immune cells was identified (Supplementary Figure S6a) and quantified. We observed a significant decrease in CD45+ leukocytes (Figure 4a). Macrophages (Figure 4b), including both major histocompatibility complex II high and negative populations (Supplementary Figure S6b and c), as well as dendritic cells (DCs) and Langerhans cells were also significantly decreased on A485 treatment (Supplementary Figure S6d and e). Although there was a slight reduction in CD4 T cells, including T regulatory cells, as well as CD8 T cells, γδ T cells in particular were significantly decreased on A485 treatment (Supplementary Figure S6f‒i). We next evaluated immune cell populations by immunofluorescence stainings. We found a significant decrease in the CD45-positive area (Figure 4c) as well as in the CD68-positive area (Figure 4d), whereas the CD4- or CD8-positive areas were not strongly affected by A485 treatment (Supplementary Figure S6j and k). We also found a statistically not significant reduction of CD4-positive IL17A-producing cells under A485 treatment (Supplementary Figure S4b and c), which is in agreement with our results that A485 mainly attenuated IMQ-induced Il23 mRNA expression but only slightly reduced Il17a mRNA expression (Figure 4e and f). There was a trend toward a reduced area of positive TCR staining, which marks γδ T cells (Supplementary Figure S6l).
Figure 4Inflammatory cell infiltration is reduced by A485 treatment. (a) Representative flow cytometry plots of CD45+ cells in inflamed ears of mice that received DMSO vehicle (left) or A485 (right) and their quantification shown as the percentage of total single living cells (n = 3‒4 mice per group). (b) Representative flow cytometry plots of CD45+F4/80+CD11c‒ macrophages in inflamed ears of mice that received DMSO vehicle (left) or A485 (right) and their quantification shown as the percentage of total single living cells (n = 3‒4 mice per group). (c) Representative immunofluorescence images of inflamed ear skin sections of mice that received DMSO vehicle or A485 stained for CD45 (green) and Hoechst (blue) and quantification thereof (n = 6‒8 mice per group). Values are normalized to BM length. (d) Representative immunofluorescence images of inflamed ear skin sections of mice that received DMSO vehicle or A485-stained for CD68 (red) and Hoechst (blue) and quantification thereof (n = 6‒8 mice per group). Values are normalized to BM length. Bars = 100 μm. (e‒h) Gene expression levels of (e) Il17a, (f) Il23p19, (g) Tnf, and (h) Stat3 in inflamed ear tissues under vehicle or A485 treatment (n = 5‒6 mice per group). Data represent mean ± SD. Significance was determined by unpaired Student’s t-test. ∗P < 0.05 and ∗∗P < 0.01. BM, basement membrane; SSC-A, side scatter area; STAT3, signal transducer and activator of transcription 3.
We next evaluated changes in the expression of Il17a, Il23p19, Tnf, and signal transducer and activator of transcription 3 gene Stat3 because these genes have been shown to play pivotal roles in psoriasis (
). Il23p19 expression showed a significant decrease under A485 treatment. Il17a showed a trend toward reduced expression after treatment, whereas Tnf and signal transducer and activator of transcription 3 showed no major changes (Figure 4e‒h). IL23 is predominantly expressed by macrophages and DCs (
), which is in line with the flow cytometry results.
Overall, these results indicate that A485 alleviates skin inflammation by reducing keratinocyte proliferation and normalizing EDA FN production as well as immune cell infiltration and Il23 expression.
Discussion
Despite the currently available treatments for psoriasis, including biologics and topical treatments, the disease often relapses and occurs at the same sites where the inflammation was previously present. One possible explanation for the reoccurrence of psoriasis might be an epigenetic memory of skin cells contributing to the pathogenesis of psoriatic skin lesions. Indeed, recent studies suggest that the acquisition of chemoresistance during the recurrences of cancers, such as leukemia (
), can be partially attributed to epigenetic mechanisms. Previous studies have reported that changes in DNA methylation reverted to baseline under treatment (
), indicating the dynamics of epigenetic modifications in psoriasis. New therapeutic approaches using epigenetic modifier drugs are currently being developed against a multitude of diseases, in particular cancers. Recently, epigenetic modifications have also been suggested to occur in chronic inflammatory diseases, including psoriasis (
). In this study, we identified the selective EP300/CBP inhibitor, A485, through an epigenetic modifier drug library screening performed on fibroblasts derived from psoriasis plaques and confirmed its therapeutic potential in a mouse model of psoriasis-like skin inflammation.
The finding that distinct transcriptomic patterns of psoriatic fibroblasts were maintained in culture suggests the preservation of their epigenetic memory. Several genes, including EDA FN and ITGA4, remained significantly upregulated in cultured fibroblasts derived from psoriatic skin. In line with our data, previous studies have shown that upregulation of EDA FN is typically observed in cancer and in inflammatory conditions, including psoriatic skin lesions (
Extra domain A-containing fibronectin expression in Spin90-deficient fibroblasts mediates cancer-stroma interaction and promotes breast cancer progression.
). The implications of EDA FN and ITGA4 upregulations for psoriasis pathogenesis remain incompletely understood at present. VLA-4, composed of the integrin α4 and β1 chain, is a known receptor of EDA FN, mediating adhesion to the ECM and also to activated endothelium (
). A previous study reported that remodeling of the FN matrix in diseased tissue elicits an extra domain A‒dependent inflammatory response in dermal fibroblasts (
) that EDA FN modulates fibroblast differentiation through a mechanism that involves binding of EDA FN to the ITGAα4/β7, which is followed by the activation of focal adhesion kinase and MAPK signaling pathways.
Psoriatic skin undergoes several epigenetic modifications in terms of DNA methylation, histone modification, and noncoding RNA expression. For example, PBMCs from patients with psoriasis have reduced histone H3 and H4 acetylation levels and increased H3K4 methylation (
). A recent study found that histone modifications were associated with the responsiveness to biologics in patients with psoriasis. Although methylation of H3K27 showed comparable patterns in healthy controls and in patients with psoriasis who did not receive any treatment, there was a significant increase after the treatment only in patients who responded to the treatments (
). This suggests that epigenetics states are dynamically changed during psoriasis pathogenesis, in agreement with our gene set enrichment analysis showing that the downregulated genes in psoriatic fibroblasts were significantly enriched in ontologies related to chromatin and histone modifications such as HIST1H, SIRT2 (which inhibits transcriptional activation by deacetylating EP300, the target protein of A485), HDACs (histone deacetylases), SMARCA, and HAT1. A very recent study showed that demethylation of H3K27 in CD4 T cells was involved in the generation of effector T cells in autoimmune diseases and drove T helper 17 differentiation (
), which is vital for the production of IL-23 and IL-17. Thus, alterations of H3K27 methylation and acetylation may also contribute to immune modulation and disease control in response to treatment.
We designed the screening of epigenetic inhibitor molecules to evaluate their efficacy in reducing the elevated expression of EDA FN and ITGA4 in psoriatic fibroblasts. The epigenetic library contained different kinds of inhibitors, each targeting different epigenetic writers, readers, erasers, or transcriptional regulators. Inhibition of EP300/CBP proteins showed consistent effectiveness in the downregulation of the target genes, in line with a recent study that revealed that CBP/p300 mediated ECM organization and remodeling in synovial fibroblasts (
). Although EP300 (p300) and CBP did not show differential expression levels between psoriatic and healthy fibroblasts, their enzymatic activity on histone acetylation could be different under inflammatory condition. The most potent and consistent effect was observed with (+)-JQ1, A485, I-CBP112, and SGC-CBP30. The inhibitory effect of (+)-JQ1 on fibroblast proliferation is compatible with the findings from previous studies reporting that (+)-JQ1‒mediated bromodomain inhibition triggers cell cycle arrest (
), and (+)-JQ1 was hence excluded from further experiments. The p300/CBP inhibitors tested reduced the gene expression of our target genes, EDA FN and ITGA4, without impacting cell proliferation, indicating their possible suitability for in vivo usage. In comparison, I-CBP112 and SGC-CBP30 treatment resulted in a less pronounced reduction in EDA FN levels compared with those of A485.
I-CBP112, SGC-CBP30, and A485 act on the same target, the p300/CBP proteins (
), suggesting the importance of CBP/P300 activity in controlling the expression of the target genes in fibroblasts. CBP/p300 contains multiple domains that are biologically relevant; hence, specific inhibition of specific domains of CBP/p300 by small molecules has been used as a therapeutic strategy in several diseases (
) are inhibitors of the BRD activity of CBP/p300 proteins. The BRD binds preferentially to diacetylated and triacetylated histones H4 and H2B. The BRD is crucial for CBP/p300-mediated histone acetylation because its deletion impairs the ability to acetylate histones (
). On the other hand, A485 is an inhibitor targeting the HAT domain of the CBP/p300 proteins. A485 treatment did not alter p300 or CBP protein levels but selectively inhibited HAT (
). In general, CBP/p300 preferentially acetylates H3K18/K27, whereas A485 inhibits that acetylation and leads to a marked decrease in acetylation within the CBP/p300 activation loop (
To assess the therapeutic efficacy of A485 in vivo, we used a mouse model of IMQ-induced psoriasis-like skin inflammation. After applying IMQ cream to mouse ear skin, the ears developed characteristic features of psoriasis, including epidermal thickening, erythema, scaling, immune cell infiltration, and upregulation of proinflammatory cytokines such as IL-17 and IL-23 (
). Systemic treatment with A485 significantly reduced the development of psoriatic skin lesions. Thus, our results show that targeting acetylation of H3K27 by A485 not only suppresses EDA FN and ITGA4 expression in psoriatic fibroblasts but also inhibits skin inflammation, immune cell infiltration, and the expression of key genes of psoriasis pathogenesis. These findings of the efficacy of an epigenetic modifier drug in a psoriasis model are in agreement with those of a previous study reporting the beneficial effects of another epigenetic modifier drug (+)-JQ1, a BET1 domain inhibitor, in IMQ-induced skin inflammation in mice. Although (+)-JQ1 attenuated IMQ-induced IL-17A but not IL-23 levels, A485 reduced the level of Il23 but not those of Il17a, suggesting that (+)-JQ1 and A485 may act through different mechanisms (
), and acetylation through epigenetic modifier drug treatments may contribute to immune modulation and disease control of psoriasis. H3K27 acetylation as well as methylation may also have a potential role as future biomarkers for psoriasis. The level of H3K27 acetylation in psoriatic skin was significantly higher than in healthy skin tissue, which is in agreement with the findings of a previous study (
), which reported that the H3K27ac pattern was different between psoriatic and uninvolved or healthy skin by showing the correlation of overexpressed genes with enrichment of H3K27ac levels in psoriasis.
The resolution of the psoriatic phenotype after A485 treatment was likely due to direct effects on fibroblasts as well as potentially on several other skin cell types, including keratinocytes and ECs. The reduced number of leukocytes in inflamed mouse ears, including macrophages, DCs, Langerhans cells, and γδ T cells, indicates the potential effects of A485 on immune cells as well. These effects could have been direct and also indirect by reducing the production of inflammatory mediators by dermal fibroblasts. A potential pathogenic role of macrophages is supported by previous findings of a strong production of TNF-α by macrophages in the IL-23‒induced psoriasis-like inflammation mouse model, where the mRNA expression levels of Tnf, Il1ß, Il17a, and ß-defensin were strongly decreased in the ear skin on prophylactic depletion of macrophages (
). Dermal γδ T cells constitutively express CCR6 and, together with T helper 17 cells, produce a multitude of cytokines, such as IL-23 and IL-17. Ccr6-knockout mice were resistant to IL-23‒induced skin inflammation, underpinning the indispensability of CCR6 in response to IL-23 stimulation (
). Although TCRα-deficient mice responded to IL-23 in the same way as wild-type mice, TCRδ-deficient mice showed significantly reduced epidermal thickening, neutrophil infiltration, and IL-17 production in the model of IMQ-induced psoriasis-like inflammation (
), suggesting that γδ T cells are more crucial than CD4 or CD8 T cells in this model.
The strong reduction in DCs, including Langerhans cells, with a significant decrease in Il23p19 by A485 treatment, is particularly noteworthy. DCs are the primary source of IL-23, a key cytokine in the establishment and development of psoriasis. Blocking of the IL-23 subunits IL-12/23p40 or IL-23p19 showed more prominent therapeutic efficacy than conventional treatments in moderate-to-severe psoriasis, implicating that IL-23 production from inflammatory DCs is critical to psoriasis pathogenesis (
), suggesting that IL-23‒producing DC subsets might define the inflammatory DCs in psoriasis pathogenesis. Collectively, our findings indicate that A485 exerts its anti-inflammatory effects primarily through macrophages, γδ T cells, and Langerhans cells. It will be of great interest to examine, in future studies, more specifically the distinct effects of A485 in vivo on fibroblasts, epithelial cells, and ECs, in particular with regard to their EDA FN and ITGA4 expression levels. Overall, our findings suggest that epigenetic modifications play an important role in psoriasis pathogenesis and that epigenetic modifier drugs might represent, to our knowledge, a previously unreported therapeutic strategy for the treatment of psoriasis.
Materials and Methods
More materials and methods can be found online as Supplementary Materials and Methods.
Isolation and culture of human dermal fibroblasts
The epidermis was removed after overnight incubation with 0.25% trypsin (Sigma-Aldrich, St. Louis, MO) in Dulbecco's PBS (Gibco, Waltham, MA) at 4 °C. The dermis was digested mechanically and enzymatically with 1,000 U/ml collagenase type I (Worthington Industries, Columbus, OH) and 40 μg/ml DNase (Roche, Basel, Switzerland) in RPMI medium supplemented with 10% fetal bovine serum, 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, and 1% antibiotics (all from Gibco) at 37 °C for 40 minutes. Cell suspensions obtained from the digested tissue were filtered and plated on cell culture dishes. Cells were grown to confluency with regular exchange of the medium to remove nonadherent cells and cultured in FN (Merck Millipore, Darmstadt, Germany) -coated plates with EGM-2 medium (Lonza, Basel, Switzerland). To exclude ECs, CD31 Dynabeads (Invitrogen, Waltham, MA) were used according to the manufacturer’s instructions, and adherent CD31-negative cells were cultured as fibroblasts. Cells were cultured in DMEM supplemented with high glucose (4.5 g/l D-glucose), L-glutamine, pyruvate, 1% antibiotics, and 10% fetal bovine serum (all Gibco) and used for all in vitro assays until passage 6. Cells were passaged every 3‒4 days when they reached 80% confluence. Cells were cultured about 10 days at passage 0 after their isolation from the tissue and were routinely tested for mycoplasma contamination (Mycoscope, Genlantis, San Diego, CA).
Screening of epigenetic modifier drug library
Human dermal healthy and psoriatic fibroblasts (20,000 cells/well) were seeded into 24-well plates, and the next day, they were treated with the indicated epigenetic modifier drug or 0.1% DMSO; used as vehicle control; and diluted in DMEM supplemented with high glucose (4.5 g/l D-glucose), L-glutamine, pyruvate, 1% antibiotics, and 10% fetal bovine serum (all Gibco). Used epigenetic modifiers are listed in Supplementary Table S4 with information about the used concentration and the duration of the treatment. The compound library used for the epigenetic screening consisted of 44 epigenetic modifiers (SGC epigenetic chemical probe library, Tocris Bioscience, Bristol, United Kingdom) and 5-azacytidine, trichostatin A (Sigma-Aldrich), tasquinimod, TMP 269 (SelleckChem, Houston, TX), and iP300w (Tocris Bioscience).
IMQ-induced psoriasis-like skin inflammation model
To induce skin inflammation, a 5% IMQ-containing cream (Aldara, 3M, Saint Paul, MN) was applied daily for 7 consecutive days to the ear skin of female C57BL/6 mice aged 8 weeks obtained from the Janvier Labs (Le Genest-Saint-Isle, France). Each mouse received daily intraperitoneal injections of 10% DMSO in corn oil as the vehicle control or 100 mg/kg of A485 (MedChemExpress, Monmouth Junction, NJ) diluted in 10% DMSO in corn oil. Ear thickness and PASI score were measured daily, and mice were euthanized on day 7. The mice used in this study were housed in the animal facility of the Swiss Federal Institute of Technology (Zurich, Switzerland) under specific pathogen-free conditions. All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. Special care was used to limit animal discomfort throughout the whole study.
Study approval
Surplus human samples were obtained from the plastic surgery department and the Department of Dermatology, University Hospital of Zürich with the assistance of the SKINTEGRITY.CH biobank. Only material from patients who had signed written informed consent was used. The use of material for research purposes was approved by the cantonal ethic commission (Ethics Committee of the Canton Zurich, number 2017-00687). Mouse experiments were performed in accordance with licenses ZH212/16 approved by Kantonales Veterinäramt Zürich.
Data availability statement
RNA-sequencing datasets can be found at https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-11098, hosted at ArrayExpress under accession number E-MTAB-11098. Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Michael Detmar ([email protected]).
MPL received research funding for unrelated projects from Roche, Novartis, Molecular Partners, and Oncobit AG. The remaining authors state no conflict of interest.
Acknowledgments
We would like to thank Cornelia Halin, Lothar Dieterich, and Eliane Sibler (Swiss Federal Institute of Technology, Zurich, Switzerland) for their valuable input regarding experimental design and results. We also thank Jeannette Scholl (Swiss Federal Institute of Technology), Catharine Aquino (Functional Genomics Center Zurich, Zurich, Switzerland), and Emilio Yángüez (Functional Genomics Center Zurich) for excellent technical assistance. This research was funded by Swiss National Science Foundation grant 310030B_185392, European Research Council grant LYVICAM, by University Medicine Zurich (Flagshipproject SKINTEGRITY) and by the ETH Zurich (Open ETH project SKINTEGRITY.CH).
RNA was extracted from healthy and psoriatic fibroblasts using the NucleoSpin RNA kit (Macherey-Nagel, Duren, Germany) according to the manufacturer’s instructions. RNA quantity and quality were assessed using a bioanalyzer (Agilent, Santa Clara, CA). cDNA libraries were generated from 100 ng of high-quality RNA samples (RNA integrity number > 9) and subjected to paired-end (150 bp) sequencing for 30 million reads per sample on average using the Illumina Hiseq4000 system in collaboration with the Functional Genomics Center Zurich (Zurich, Switzerland). Reads were aligned to the Ensembl human genome assembly GRCh38 using STAR, version 2.4.2a (
), and the cutoff was defined as log2 fold change > 0.6 and P < 0.05. The heatmaps were generated with ggplot2 (version 3.2.0), and gene expression was normalized and shown as the percent of maximum gene expression for each gene. All bioinformatical analyses were performed in R (version 3.4.0). Gene ontology analyses were performed using the PANTHER classification system (
). Briefly, human dermal healthy and psoriatic fibroblasts (2,500 cells/well) were seeded into black 96-well plates (Corning Costar, Raleigh, NC) and cultured in DMEM supplemented with high glucose (4.5 g/l D-glucose), L-glutamine, pyruvate, 1% antibiotics, and 10% fetal bovine serum (all Gibco, Waltham, MA). At the indicated timepoints, 100 μg/ml of 4-methylumbelliferyl heptanoate (Sigma-Aldrich, St. Louis, MO) in Dulbecco's PBS was added, and the fluorescence intensity was measured on a SpectraMax reader (Molecular Devices, San Jose, CA) at 355 nm excitation and 460 nm emission. For each condition, at least quintuplicates were analyzed.
Quantitative PCR
RNA was isolated from cultured cells as described in the materials and methods or from imiquimod-inflamed ear tissues lysed with a TissueLyser II (Qiagen, Hilden, Germany) and extracted with the Nucleospin RNA kit (Macherey-Nagel). RNA was measured using a NanoDrop ND-1000 spectrophotometer (Witec, Ulm, Germany) and retrotranscribed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA). Gene expression was measured by qPCR with the PowerUp SYBR green master mix (Thermo Fisher Scientific, Waltham, MA) on a QuantStudio Real-Time PCR System, version 1.3 (Applied Biosystems). Expression data were normalized on the basis of the expression levels of GAPDH, which was used as an internal housekeeping gene. Primer sequences for human cells were GAPDH forward 5′-GGAATCCCATCACCATCTTCCAGG-3′ and GAPDH reverse 5′-GAGCCCCAGCCTTCTCCATG-3′, extradomain A fibronectin (EDA FN) forward 5′-CATTCACTGATGTGGATGTC-3′ and EDA FN revers 5′-CAGTGTCTTCTTCACCATCA- 3′, and ITGA4 forward 5′-AACACGCTGTTCGGCTACTC-3′ and ITGA4 reverse 5′-TGGAAAGTGTGACCCCCAAC-3′. Primer sequences for mouse tissues were Gapdh forward 5′-CCTGGAAAACCTGCCAAGTATG-3′ and Gapdh reverse 5′-AGAGTGGGAGTTGCTGTTGAAGTC-3′, EDA Fn forward CCCTAAAGGACTGGCATTCA and EDA Fn reverse CATCCTCAGGGCTCGAGTAG, and Fn1 forward CACATGAGACTGGTGGCTACA and Fn1 reverse TTCTGGAGGTACAGGTGATGC, Itga4 forward CTGGAGGAGAGGGATAACC and Itga4 reverse CCCACAAGTCACGATAGAG, Il17a forward 5′-TCAGCGTGTCCAAACACTGAG-3′ and Il17a reverse 5′-CGCCAAGGGAGTTAAAGACTT-3′, Tnf forward 5′-GCGGAGTCCGGGCAGGTCTA-3′ and Tnf reverse 5′-GGGGGCTGGCTCTGTGAGGA-3′, Il23p19 forward 5′-GGAGCAACTTCACACCTCC-3′ and Il23p19 reverse 5′-GGCAGCTATGGCCAAAAAGG-3′, signal transducer and activator of transcription 3 gene Stat3 forward 5′-CCCCCGTACCTGAAGACCAAG-3′ and signal transducer and activator of transcription 3 gene Stat3 reverse 5′-TCCTCACATGGGGGAGGTAG-3′, Pdgfra forward 5′-TTTACATCTATGTACCAGACCC-3′ and Pdgfra reverse 5′-CATCCTCTTCCACGATGAC-3′, and vimentin forward 5′-CCCTTAAAGGCACTAACGAG-3′ and vimentin reverse 5′-GGTAGTTAGCAGCTTCAAGG-3′.
Western blot
Cells or ear skin tissue were lysed with lysis buffer (25 mM 4-[2-hydroxyethyl]-1-piperazineethanesulfonic acid, 5 mM EDTA, 1% Triton-X, 150 mM sodium chloride, 10% glycerol, complete protease inhibitor cocktail or 50 mM Tris, 5 mM EDTA, 1% Triton-X, 150 mM sodium chloride, 1 mM sodium orthovanadate, 25 mM sodium fluoride, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, complete protease inhibitor cocktail) and then centrifuged at 10,000g for 5 minutes at 4 °C to collect the supernatant. The protein concentration in lysates was determined using the Microplate BCA protein assay kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. Proteins were separated by SDS-PAGE using 4–12% Bis-Tris gels (NuPAGE, Life Technologies, Carlsbad, CA) and transferred to polyvinylidene fluoride membranes (Invitrogen, Waltham, MA). Membranes were blocked with 5% BSA diluted in Tris-buffered saline 0.1% Tween and incubated with anti‒EDA FN (1:2,000, ab6328, Abcam, Cambridge, United Kingdom) IST-9 antibody, anti‒β-actin antibody (1:1,000, ab8227, Abcam), anti‒acetylation of lysine 27 on histone 3 antibody (1:1,000, ab4729, Abcam), and anti-H3 antibody (1:1,000, ab18521, Abcam), followed by horseradish peroxidase‒conjugated anti-mouse (1:10,000, P0161, Dako, Santa Clara, CA) or anti-rabbit (1:10,000, P0448, Dako) secondary antibodies. To develop the membrane, the Clarity Western ECL Substrate (Bio-Rad Laboratories, Hercules, CA) was used, and chemiluminescence signals were visualized by a ChemiDoc (Bio-Rad Laboratories).
Sequential chromatin immunoprecipitation followed by qPCR after A485 treatment
Sequential chromatin immunoprecipitation‒qPCR experiments were performed as previously described (
) with modifications. A total of 1 × 107 fibroblasts were treated with 0.8 μM of A485 or vehicle control for 3 days and harvested. After the fixation, sonication of fibroblast nuclei was performed using a Covaris S220 system (Covaris, Woburn, MA; peak power: 140, duty factor: 5.0%, cycles per burst: 200) for 12 on/off cycles of 1 minute. Antibody prebinding was performed as follows: 1.25 mg Dynabeads protein A magnetic beads (Thermo Fisher Scientific) were washed twice with 1 ml of blocking solution (0.5% BSA in Dulbecco's PBS). Then, Dynabeads were incubated with rabbit anti-CBP/p300 antibody (1:50, Cell Signaling Technology, Danvers, MA) for 3 hours at 4 °C by rotating. As a control antibody, rabbit IgG control was used (Sigma-Aldrich). After washing once with 1 ml of blocking solution, antibody-bound beads were added to fibroblast nuclear lysates and incubated overnight at 4 °C with slow rotation. Aliquots of 6 μl nuclear lysate were used as input DNA. The next day, antibody-bound beads were washed twice with 1 ml RIPA buffer (50 mM 4-[2-hydroxyethyl]-1-piperazineethanesulfonic acid-potassium hydroxide, pH 7.5; 500 mM LiCl; 1 mM EDTA, pH 8; 1% igepal CA-630; and 0.7% sodium deoxycholate) and once with Tris-buffered solution (20 mM Tris-hydrogen chloride pH 8, 150 mM sodium chloride). To eluate immunocomplexes from the beads, 10 mM dithiothreitol was added and incubated for 30 minutes at 37 °C, and the supernatant was collected. In the meantime, antibody prebinding was performed as described earlier using acetylation of lysine 27 on histone 3 (1:100, Abcam) and rabbit IgG control antibodies. Antibody-bound beads were mixed with the supernatant and incubated overnight at 4 °C with slow rotation. After the elution of DNA, the MiniElute PCR purification kit (Qiagen) was used for DNA isolation. qPCR was performed as described earlier. Target region Ct values were normalized to DNA input, and then enrichment against IgG isotype control was calculated. Primers were designed on the basis of acetylation of lysine 27 on histone 3 chromatin immunoprecipitation sequencing peaks of normal human dermal fibroblasts (ENCSR000APN) from the ENCODE project. The primers for chromatin immunoprecipitation‒qPCR were as follows: FN1 forward 5′-CGCTGAGAAGGGAAGAAGTC-3′ and FN1 reverse 5′- CTGACTCGGGACTCCCTTATT-3′ and ITGA4 forward 5′-AGCATCAGATGGTGGTTGATA-3′ and ITGA4 reverse 5′-CCCAAGGTCACACCACTTGT-3′.
Immunofluorescence staining and analysis of frozen mouse ear sections
Optical cutting temperature‒embedded ear samples of imiquimod-treated mice, human psoriasis, and healthy skin biopsies were frozen on liquid nitrogen. A total of 7 μm cryostat sections were fixed with acetone, dehydrated in 80% methanol, and incubated with blocking solution (5% donkey serum, 0.1% Triton-X, and 1% BSA in PBS) for 1 hour. Tissue sections were incubated with the primary antibodies in a blocking solution at 4 °C overnight. Primary antibodies against CD31 (BD550274, 1:200, BD, Franklin Lakes, NJ), LYVE1 (11-034, 1:600, Angiobio, San Diego, CA), keratin 6 (PRB-169P, 1:200, Covance, Princeton, NJ), Ki-67 (14-5698, 1:200, Invitrogen), CD45 (AF114, 1:100, R&D Systems, San Diego, CA), CD3 (MCA1477T, 1:100, Bio-Rad Laboratories), CD4-biotin (BD553045, 1:100, BD Biosciences, San Jose, CA), CD4 (553647, 1:100, BD Pharmingen, San Diego, CA), CD8a (BD553029, 1:100, BD Biosciences), TCR (ab118868, 1:50, Abcam), CD68 (ab53444, 1:200, Abcam), IL17A (ab79056, 1:400, Abcam), and acetylation of lysine 27 on histone 3(ab4729, 1:1,000, Abcam) were used. After abundant washes in PBS, Alexa Fluor 488‒, Alexa Fluor 594‒, or Alexa streptavidin‒conjugated secondary antibodies and Hoechst 33342 (all purchased from Invitrogen; Alexa secondary antibodies; 1:200, Hoechst 33342; 1:1,000) were added for 2 hours at room temperature. Slides were mounted with Mowiol mounting medium. Mouse ear skin or human skin sections were imaged with an Axioskop2 mot plus microscope (Carl Zeiss, Jena, Germany) with an AxioCam MRc camera (Carl Zeiss). For each sample, at least four images were obtained and quantified using ImageJ (National Institutes of Health, Bethesda, MD) in a blind fashion.
Flow cytometry
For the purity check of isolated fibroblasts, fibroblasts (100,000 cells) from psoriatic and healthy tissue were collected after CD31 dynabeads-negative selection. Fibroblasts were washed with FACS buffer (Dulbecco's PBS with 2% fetal bovine serum and 1 mM EDTA) and stained with phycoerythrin/Cy7-conjugated mouse anti-human PDGFRa (323508, 10 μg/ml, BioLegend, San Diego, CA), phycoerythrin-conjugated mouse anti-human CD31 (BD555446, 1:20, BD Pharmingen), and allophycocyanin-conjugated rat anti-human CD49f (17-0495-82, 0.4 μg/ml, eBioscience, San Diego, CA) antibodies diluted in FACS buffer for 30 minutes at 4 °C. After a wash with FACS buffer, cells were fixed with 1% paraformaldehyde. Fibroblasts were defined as PDGFRa-positive and CD31- and CD49f-negative cells. Human endothelial cells (CD31 positive), human keratinocytes (CD49f positive), and dermal fibroblasts (PDGFRa positive) were used as the respective positive controls. Human endothelial cells were obtained from the CD31-positive selection described earlier. Human keratinocytes and dermal fibroblasts were obtained from plastic surgery as described previously (
). Samples were acquired on a Cytoflex S (Beckman Coulter, Brea, CA) using CytoExpert software. Analysis was performed using FlowJo, version 10.5 (BD Biosciences).
To evaluate immune cell infiltrate in mouse inflamed skin, ears were harvested on day 7 after imiquimod challenge. After mechanical disruption of the tissue, samples were digested under rotation in DMEM (Gibco) containing 4 mg/ml collagenase IV (Gibco) and 40 μg/ml DNase (Roche, Basel, Switzerland) at 37 °C for 40 minutes. Samples were filtered through 40 μm strainers (Falcon, Mexico City, Mexico), centrifuged, and resuspended in FACS buffer containing 2% fetal bovine serum (Gibco) and 2 mM EDTA (Fluka Chemie, Buchs, Switzerland) in Dulbecco's PBS. Samples were incubated with anti-mouse CD16/32 antibody (1:100, BioLegend) on ice for 20 minutes and subsequently stained on ice for 30 minutes using CD11b-BV605 (101237, 1:100, BioLegend), F4/80-AF647 (AbD MCA497A647, 1:100), CD45-PB (103126, 1:400, BioLegend), GDTCR-PerCP710 (46-5711-82, 1:400, eBioscience), CD11c-PE-Cy7 (117318, 1:400, BioLegend), major histocompatibility complex II‒AF700 (107622, 1:800, BioLegend), CD4-FITC (100405, 1:100, BioLegend), CD8-allophycocyanin-Cy7 (100714, 1:100, BioLegend), and langerin-biotin (13-2075-82, 1:100, eBioscience). Cells were incubated with streptavidin-BV650 for 20 minutes. Live/dead cell staining with Zombie Aqua (423102, 1:500, BioLegend) was done together with the antibody incubation. To quantify T regulatory cells, intracellular staining was performed with Foxp3-phycoerythrin (12-5773-80, 1:100, eBioscience) using an intracellular staining kit (72-5775, eBioscience) following the manufacturer’s instructions. Samples were acquired on an LSRFortessa (BD Biosciences) using FACSDiva software. The analysis was performed using FlowJo, version 10.5 (BD Biosciences) in a blinded fashion.
Statistics
Statistical analysis was performed with GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA) using unpaired or paired two-tailed Student’s t-test or two-way ANOVA, as indicated. Data are shown as mean plus SD, and differences were considered statistically significant when P < 0.05, as indicated by asterisks with ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, and ∗∗∗∗P < 0.0001.
Supplementary Figure S1The purity of fibroblasts and enriched terms in psoriatic fibroblasts. (a) Flow cytometry analysis of CD49f and CD31 in dermal fibroblasts from both healthy skin and psoriatic skin lesions. FMO was used as a staining control. (b) Dot plot of gene ontology enrichment analysis using KEGG (
) showing the most upregulated terms in psoriatic fibroblasts expressed as gene ratio (overlap) and ‒log10(P-value). EC, endothelial cells; ECM, extracellular matrix; FMO, fluorescence minus one; FSC-H, forward scatter height; GO:BP, gene ontology biological process; KC, keratinocyte; KEGG, kyoto encyclopedia of genes and genomes; SSC-A, side scatter area.
Supplementary Figure S2Distinct gene expression in psoriatic fibroblasts and suppression of target genes by p300/CBP HAT inhibitors. (a) Heatmap and (b) enrichment plots from GSEA (
) showing that genes downregulated in psoriatic fibroblasts are enriched for chromatin assembly or disassembly, chromatin organization, and remodeling. Running ES score and positions of Gene set members on the rank-ordered list based on the significance value from GSEA. (psoriatic, n = 3 and healthy fibroblasts, n = 6). (c, d) Enrichment for CBP/p300 and H3K27ac at (c) FN1 and (d) ITGA4 genomic loci displayed as fold change against IgG control after vehicle or A485 treatment in fibroblasts. (e, f) Downregulation of (e) EDA FN and (f) ITGA4 after vehicle or iP300 treatment (0.3 μM) for 72 hours in fibroblasts. Data represent mean ± SD. Significance was determined by unpaired Student’s t-test. ∗∗P < 0.01 and ∗∗∗P < 0.001. EDA FN, extra domain A of fibronectin; ES, enrichment score; FDR, false discovery rate; GSEA, gene set enrichment analysis; H3K27ac, acetylation of lysine 27 on histone 3; HAT, histone acetyltransferase; NES, normalized enrichment score.
Supplementary Figure S3The level of H3K27ac in human healthy and psoriatic skin. (a) Representative immunofluorescence images of healthy and psoriatic skin (n = 4 per group) stained for nuclei (Hoechst; blue) and H3K27ac (red). Bars = 100 μm. (b) Quantification of the H3K27ac-positive area in dermis and epidermis (n = 4 per group). Data represent mean ± SD. Significance was determined by unpaired Student’s t-test. ∗P < 0.05 and ∗∗P < 0.01. H3K27ac, acetylation of lysine 27 on histone 3.
Supplementary Figure S4The effect of systemic administration of A485. (a) Average body weight of mice treated with A485 or vehicle control. The mean body weights of the mice in each group (n = 6‒8) were measured. (b) Representative immunofluorescence images of inflamed ears of mice that received DMSO vehicle or A485 (n = 3 mice per group) stained for CD4 (green), IL17A (red), and Hoechst (blue). Bars = 100 μm. (c) Quantification of CD4+IL17A+ cells per total CD4+ immune cells in inflamed ears of mice that received DMSO vehicle or A485, shown as the percentage of CD4+IL17A+ cells of total CD4+ cells (n = 3 mice per group). (d) The mRNA expression levels of Fn1, EDA Fn, and Itga4 normalized per vimentin and Pdgfra mRNA levels in mice treated with A485 or vehicle control (n= 6‒8 mice per group). All data represent mean ± SD. Significance was determined by two-way ANOVA test with Sidak’s correction for multiple comparisons in a or by unpaired Student’s t-test for c and d. ∗P < 0.05 and ∗∗P < 0.01. EDA FN, extra domain A of fibronectin; ns, not significant.
Supplementary Figure S5A485 treatment does not affect lymphatic or blood vessels. (a) Representative immunofluorescence images of inflamed ears of mice that received DMSO vehicle or A485 (n = 6‒8 mice per group) stained for LYVE1 (green), CD31 (red), and Hoechst (blue). Bar = 100 μm. (b) The number of CD31-positive LYVE1-positive lymphatic vessels and (c) quantification of lymphatic vessel area in inflamed ears of mice that received the indicated treatment (n = 6‒8 mice per group). (d) The number of CD31-positive LYVE1-negative blood vessels and (e) quantification of blood vessel area in inflamed ears of mice that received the indicated treatment (n = 6‒8 mice per group). The numbers of vessels are normalized to BM length, and the area of vessels is expressed as the percentage of the analyzed area. Data represent mean ± SD. Significance was determined by unpaired Student’s t-test. BM, basement membrane.
Supplementary Figure S6Inflammatory cell infiltration in inflamed ears. (a) FACS gating strategy for immune cell subpopulations in inflamed ear tissues (n = 3‒4 mice per group). Alive single cells were selected for CD45 positivity. All gates were set on the basis of FMO controls (except for CD45). (b‒i) Quantification of MHCII-high and -negative macrophages, DCs, Langerhans cells, CD4, CD8, Tregs, γδ T cells in inflamed ears of mice that received DMSO vehicle or A485 by flow cytometry and shown as the percentage of total single living cells (n = 3‒4 mice per group). (j‒l) Quantification of CD4, CD8, and TCR stainings in inflamed ears of mice that received DMSO vehicle or A485 (n = 6‒8 mice per group). Data represent mean ± SD. Significance was determined by unpaired Student’s t-test. ∗P < 0.05, and ∗∗P < 0.01. DC, dendritic cell; FMO, fluorescence minus one; FSC-A, forward scatter area; FSC-H, forward scatter height; K, thousand; MHCII, major histocompatibility complex II; SSC-A, side scatter area; Treg, regulatory T cell.
Extra domain A-containing fibronectin expression in Spin90-deficient fibroblasts mediates cancer-stroma interaction and promotes breast cancer progression.
A high-affinity human monoclonal antibody specific to the alternatively spliced EDA domain of fibronectin efficiently targets tumor neo-vasculature in vivo.